ID: 1043611979

View in Genome Browser
Species Human (GRCh38)
Location 8:82076195-82076217
Sequence TAATTTTTATTTATTATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043611978_1043611979 -10 Left 1043611978 8:82076182-82076204 CCTGGTAAATGGATAATTTTTAT No data
Right 1043611979 8:82076195-82076217 TAATTTTTATTTATTATAAATGG No data
1043611975_1043611979 14 Left 1043611975 8:82076158-82076180 CCATTTTGTATATGGTCAATTGT No data
Right 1043611979 8:82076195-82076217 TAATTTTTATTTATTATAAATGG No data
1043611973_1043611979 22 Left 1043611973 8:82076150-82076172 CCTATTGGCCATTTTGTATATGG No data
Right 1043611979 8:82076195-82076217 TAATTTTTATTTATTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043611979 Original CRISPR TAATTTTTATTTATTATAAA TGG Intergenic
No off target data available for this crispr