ID: 1043611980

View in Genome Browser
Species Human (GRCh38)
Location 8:82076196-82076218
Sequence AATTTTTATTTATTATAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043611975_1043611980 15 Left 1043611975 8:82076158-82076180 CCATTTTGTATATGGTCAATTGT No data
Right 1043611980 8:82076196-82076218 AATTTTTATTTATTATAAATGGG No data
1043611978_1043611980 -9 Left 1043611978 8:82076182-82076204 CCTGGTAAATGGATAATTTTTAT No data
Right 1043611980 8:82076196-82076218 AATTTTTATTTATTATAAATGGG No data
1043611973_1043611980 23 Left 1043611973 8:82076150-82076172 CCTATTGGCCATTTTGTATATGG No data
Right 1043611980 8:82076196-82076218 AATTTTTATTTATTATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043611980 Original CRISPR AATTTTTATTTATTATAAAT GGG Intergenic
No off target data available for this crispr