ID: 1043613859

View in Genome Browser
Species Human (GRCh38)
Location 8:82101201-82101223
Sequence TTGGAAAAGCATCTTCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043613856_1043613859 4 Left 1043613856 8:82101174-82101196 CCAGGAGTCTCAGGAGCCTTACT No data
Right 1043613859 8:82101201-82101223 TTGGAAAAGCATCTTCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043613859 Original CRISPR TTGGAAAAGCATCTTCATCT AGG Intergenic
No off target data available for this crispr