ID: 1043621196

View in Genome Browser
Species Human (GRCh38)
Location 8:82194392-82194414
Sequence CAGAATATTCCCAAATATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043621196_1043621198 28 Left 1043621196 8:82194392-82194414 CCAGAATATTTGGGAATATTCTG No data
Right 1043621198 8:82194443-82194465 TCCATTGAGAGCAGATTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043621196 Original CRISPR CAGAATATTCCCAAATATTC TGG (reversed) Intergenic
No off target data available for this crispr