ID: 1043632205

View in Genome Browser
Species Human (GRCh38)
Location 8:82349809-82349831
Sequence TACCTTGACCTGGCCTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043632205_1043632208 3 Left 1043632205 8:82349809-82349831 CCAATCTAGGCCAGGTCAAGGTA No data
Right 1043632208 8:82349835-82349857 TAAGAAGTGTCAGTCAGAATGGG No data
1043632205_1043632210 9 Left 1043632205 8:82349809-82349831 CCAATCTAGGCCAGGTCAAGGTA No data
Right 1043632210 8:82349841-82349863 GTGTCAGTCAGAATGGGGCTTGG No data
1043632205_1043632211 20 Left 1043632205 8:82349809-82349831 CCAATCTAGGCCAGGTCAAGGTA No data
Right 1043632211 8:82349852-82349874 AATGGGGCTTGGAATACTCTTGG No data
1043632205_1043632209 4 Left 1043632205 8:82349809-82349831 CCAATCTAGGCCAGGTCAAGGTA No data
Right 1043632209 8:82349836-82349858 AAGAAGTGTCAGTCAGAATGGGG No data
1043632205_1043632207 2 Left 1043632205 8:82349809-82349831 CCAATCTAGGCCAGGTCAAGGTA No data
Right 1043632207 8:82349834-82349856 GTAAGAAGTGTCAGTCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043632205 Original CRISPR TACCTTGACCTGGCCTAGAT TGG (reversed) Intergenic
No off target data available for this crispr