ID: 1043653536

View in Genome Browser
Species Human (GRCh38)
Location 8:82631471-82631493
Sequence GGCCACAGCTCTTGTTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043653527_1043653536 27 Left 1043653527 8:82631421-82631443 CCACTTCCTCCCTGTAAGTTCAC No data
Right 1043653536 8:82631471-82631493 GGCCACAGCTCTTGTTTGGTTGG No data
1043653526_1043653536 30 Left 1043653526 8:82631418-82631440 CCACCACTTCCTCCCTGTAAGTT No data
Right 1043653536 8:82631471-82631493 GGCCACAGCTCTTGTTTGGTTGG No data
1043653529_1043653536 18 Left 1043653529 8:82631430-82631452 CCCTGTAAGTTCACATTAGATGG No data
Right 1043653536 8:82631471-82631493 GGCCACAGCTCTTGTTTGGTTGG No data
1043653528_1043653536 21 Left 1043653528 8:82631427-82631449 CCTCCCTGTAAGTTCACATTAGA No data
Right 1043653536 8:82631471-82631493 GGCCACAGCTCTTGTTTGGTTGG No data
1043653531_1043653536 17 Left 1043653531 8:82631431-82631453 CCTGTAAGTTCACATTAGATGGC No data
Right 1043653536 8:82631471-82631493 GGCCACAGCTCTTGTTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043653536 Original CRISPR GGCCACAGCTCTTGTTTGGT TGG Intergenic
No off target data available for this crispr