ID: 1043654504

View in Genome Browser
Species Human (GRCh38)
Location 8:82645704-82645726
Sequence CTGGTGTCTGGGGGCATAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043654504_1043654516 27 Left 1043654504 8:82645704-82645726 CCACCTATGCCCCCAGACACCAG No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654504_1043654511 -10 Left 1043654504 8:82645704-82645726 CCACCTATGCCCCCAGACACCAG No data
Right 1043654511 8:82645717-82645739 CAGACACCAGTTGCAAACCTGGG No data
1043654504_1043654513 -3 Left 1043654504 8:82645704-82645726 CCACCTATGCCCCCAGACACCAG No data
Right 1043654513 8:82645724-82645746 CAGTTGCAAACCTGGGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043654504 Original CRISPR CTGGTGTCTGGGGGCATAGG TGG (reversed) Intergenic
No off target data available for this crispr