ID: 1043654505

View in Genome Browser
Species Human (GRCh38)
Location 8:82645707-82645729
Sequence CAACTGGTGTCTGGGGGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043654505_1043654516 24 Left 1043654505 8:82645707-82645729 CCTATGCCCCCAGACACCAGTTG No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654505_1043654513 -6 Left 1043654505 8:82645707-82645729 CCTATGCCCCCAGACACCAGTTG No data
Right 1043654513 8:82645724-82645746 CAGTTGCAAACCTGGGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043654505 Original CRISPR CAACTGGTGTCTGGGGGCAT AGG (reversed) Intergenic
No off target data available for this crispr