ID: 1043654506

View in Genome Browser
Species Human (GRCh38)
Location 8:82645713-82645735
Sequence GGTTTGCAACTGGTGTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043654506_1043654516 18 Left 1043654506 8:82645713-82645735 CCCCCAGACACCAGTTGCAAACC No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043654506 Original CRISPR GGTTTGCAACTGGTGTCTGG GGG (reversed) Intergenic
No off target data available for this crispr