ID: 1043654514

View in Genome Browser
Species Human (GRCh38)
Location 8:82645734-82645756
Sequence GTCAGAAGTTCCGGAGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043654514_1043654518 19 Left 1043654514 8:82645734-82645756 CCTGGGTCTCCGGAACTTCTGAC No data
Right 1043654518 8:82645776-82645798 GTTTCCAACAATCCTCTCTTTGG No data
1043654514_1043654516 -3 Left 1043654514 8:82645734-82645756 CCTGGGTCTCCGGAACTTCTGAC No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654514_1043654519 20 Left 1043654514 8:82645734-82645756 CCTGGGTCTCCGGAACTTCTGAC No data
Right 1043654519 8:82645777-82645799 TTTCCAACAATCCTCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043654514 Original CRISPR GTCAGAAGTTCCGGAGACCC AGG (reversed) Intergenic
No off target data available for this crispr