ID: 1043654516

View in Genome Browser
Species Human (GRCh38)
Location 8:82645754-82645776
Sequence GACCAACAAGCATCAAGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043654509_1043654516 15 Left 1043654509 8:82645716-82645738 CCAGACACCAGTTGCAAACCTGG No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654506_1043654516 18 Left 1043654506 8:82645713-82645735 CCCCCAGACACCAGTTGCAAACC No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654512_1043654516 8 Left 1043654512 8:82645723-82645745 CCAGTTGCAAACCTGGGTCTCCG No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654507_1043654516 17 Left 1043654507 8:82645714-82645736 CCCCAGACACCAGTTGCAAACCT No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654505_1043654516 24 Left 1043654505 8:82645707-82645729 CCTATGCCCCCAGACACCAGTTG No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654504_1043654516 27 Left 1043654504 8:82645704-82645726 CCACCTATGCCCCCAGACACCAG No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654514_1043654516 -3 Left 1043654514 8:82645734-82645756 CCTGGGTCTCCGGAACTTCTGAC No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data
1043654508_1043654516 16 Left 1043654508 8:82645715-82645737 CCCAGACACCAGTTGCAAACCTG No data
Right 1043654516 8:82645754-82645776 GACCAACAAGCATCAAGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043654516 Original CRISPR GACCAACAAGCATCAAGTTG TGG Intergenic
No off target data available for this crispr