ID: 1043655547

View in Genome Browser
Species Human (GRCh38)
Location 8:82661124-82661146
Sequence TCTCGAAGGCAGAAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043655544_1043655547 -6 Left 1043655544 8:82661107-82661129 CCATTTTGAGTTGGGTCTCTCGA No data
Right 1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043655547 Original CRISPR TCTCGAAGGCAGAAGATGGA TGG Intergenic
No off target data available for this crispr