ID: 1043656146

View in Genome Browser
Species Human (GRCh38)
Location 8:82669265-82669287
Sequence TTTGATTTACAATCAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043656146_1043656147 -7 Left 1043656146 8:82669265-82669287 CCTGTCTCTGATTGTAAATCAAA No data
Right 1043656147 8:82669281-82669303 AATCAAAGATTACCCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043656146 Original CRISPR TTTGATTTACAATCAGAGAC AGG (reversed) Intergenic
No off target data available for this crispr