ID: 1043666807

View in Genome Browser
Species Human (GRCh38)
Location 8:82825372-82825394
Sequence CCCAAAGTCCAGATGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043666807_1043666811 -6 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666811 8:82825389-82825411 TTTGGGCACTGATGAGCACCTGG No data
1043666807_1043666822 13 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666822 8:82825408-82825430 CTGGGGGTGATGGGTGGGAGGGG No data
1043666807_1043666817 7 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666817 8:82825402-82825424 GAGCACCTGGGGGTGATGGGTGG No data
1043666807_1043666816 4 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666816 8:82825399-82825421 GATGAGCACCTGGGGGTGATGGG No data
1043666807_1043666821 12 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666821 8:82825407-82825429 CCTGGGGGTGATGGGTGGGAGGG No data
1043666807_1043666819 11 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666819 8:82825406-82825428 ACCTGGGGGTGATGGGTGGGAGG No data
1043666807_1043666813 -4 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666813 8:82825391-82825413 TGGGCACTGATGAGCACCTGGGG No data
1043666807_1043666818 8 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666818 8:82825403-82825425 AGCACCTGGGGGTGATGGGTGGG No data
1043666807_1043666814 -3 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666814 8:82825392-82825414 GGGCACTGATGAGCACCTGGGGG No data
1043666807_1043666815 3 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666815 8:82825398-82825420 TGATGAGCACCTGGGGGTGATGG No data
1043666807_1043666812 -5 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666812 8:82825390-82825412 TTGGGCACTGATGAGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043666807 Original CRISPR CCCAAAGTCCAGATGGGCCC AGG (reversed) Intergenic
No off target data available for this crispr