ID: 1043666817

View in Genome Browser
Species Human (GRCh38)
Location 8:82825402-82825424
Sequence GAGCACCTGGGGGTGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043666805_1043666817 14 Left 1043666805 8:82825365-82825387 CCTGCTGCCTGGGCCCATCTGGA No data
Right 1043666817 8:82825402-82825424 GAGCACCTGGGGGTGATGGGTGG No data
1043666803_1043666817 15 Left 1043666803 8:82825364-82825386 CCCTGCTGCCTGGGCCCATCTGG No data
Right 1043666817 8:82825402-82825424 GAGCACCTGGGGGTGATGGGTGG No data
1043666807_1043666817 7 Left 1043666807 8:82825372-82825394 CCTGGGCCCATCTGGACTTTGGG No data
Right 1043666817 8:82825402-82825424 GAGCACCTGGGGGTGATGGGTGG No data
1043666809_1043666817 1 Left 1043666809 8:82825378-82825400 CCCATCTGGACTTTGGGCACTGA No data
Right 1043666817 8:82825402-82825424 GAGCACCTGGGGGTGATGGGTGG No data
1043666802_1043666817 21 Left 1043666802 8:82825358-82825380 CCAGATCCCTGCTGCCTGGGCCC No data
Right 1043666817 8:82825402-82825424 GAGCACCTGGGGGTGATGGGTGG No data
1043666810_1043666817 0 Left 1043666810 8:82825379-82825401 CCATCTGGACTTTGGGCACTGAT 0: 18
1: 34
2: 84
3: 162
4: 303
Right 1043666817 8:82825402-82825424 GAGCACCTGGGGGTGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043666817 Original CRISPR GAGCACCTGGGGGTGATGGG TGG Intergenic
No off target data available for this crispr