ID: 1043668944

View in Genome Browser
Species Human (GRCh38)
Location 8:82856561-82856583
Sequence TCTATGATAGTGAACCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043668944_1043668945 4 Left 1043668944 8:82856561-82856583 CCATCATGGTTCACTATCATAGA No data
Right 1043668945 8:82856588-82856610 TAAAATATATCCATATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043668944 Original CRISPR TCTATGATAGTGAACCATGA TGG (reversed) Intergenic
No off target data available for this crispr