ID: 1043669583

View in Genome Browser
Species Human (GRCh38)
Location 8:82865362-82865384
Sequence CCACTTCCAGCTGGGTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043669583_1043669587 -7 Left 1043669583 8:82865362-82865384 CCTGTAAACCCAGCTGGAAGTGG No data
Right 1043669587 8:82865378-82865400 GAAGTGGTTGTCCACTTTTATGG No data
1043669583_1043669589 13 Left 1043669583 8:82865362-82865384 CCTGTAAACCCAGCTGGAAGTGG No data
Right 1043669589 8:82865398-82865420 TGGACGCATATGATTAGATTAGG No data
1043669583_1043669590 22 Left 1043669583 8:82865362-82865384 CCTGTAAACCCAGCTGGAAGTGG No data
Right 1043669590 8:82865407-82865429 ATGATTAGATTAGGTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043669583 Original CRISPR CCACTTCCAGCTGGGTTTAC AGG (reversed) Intergenic
No off target data available for this crispr