ID: 1043669585

View in Genome Browser
Species Human (GRCh38)
Location 8:82865370-82865392
Sequence GTGGACAACCACTTCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043669585_1043669590 14 Left 1043669585 8:82865370-82865392 CCCAGCTGGAAGTGGTTGTCCAC No data
Right 1043669590 8:82865407-82865429 ATGATTAGATTAGGTTCACCTGG No data
1043669585_1043669591 24 Left 1043669585 8:82865370-82865392 CCCAGCTGGAAGTGGTTGTCCAC No data
Right 1043669591 8:82865417-82865439 TAGGTTCACCTGGATAATGTAGG No data
1043669585_1043669589 5 Left 1043669585 8:82865370-82865392 CCCAGCTGGAAGTGGTTGTCCAC No data
Right 1043669589 8:82865398-82865420 TGGACGCATATGATTAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043669585 Original CRISPR GTGGACAACCACTTCCAGCT GGG (reversed) Intergenic
No off target data available for this crispr