ID: 1043669586

View in Genome Browser
Species Human (GRCh38)
Location 8:82865371-82865393
Sequence AGTGGACAACCACTTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043669586_1043669589 4 Left 1043669586 8:82865371-82865393 CCAGCTGGAAGTGGTTGTCCACT No data
Right 1043669589 8:82865398-82865420 TGGACGCATATGATTAGATTAGG No data
1043669586_1043669591 23 Left 1043669586 8:82865371-82865393 CCAGCTGGAAGTGGTTGTCCACT No data
Right 1043669591 8:82865417-82865439 TAGGTTCACCTGGATAATGTAGG No data
1043669586_1043669590 13 Left 1043669586 8:82865371-82865393 CCAGCTGGAAGTGGTTGTCCACT No data
Right 1043669590 8:82865407-82865429 ATGATTAGATTAGGTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043669586 Original CRISPR AGTGGACAACCACTTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr