ID: 1043669591

View in Genome Browser
Species Human (GRCh38)
Location 8:82865417-82865439
Sequence TAGGTTCACCTGGATAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043669588_1043669591 5 Left 1043669588 8:82865389-82865411 CCACTTTTATGGACGCATATGAT No data
Right 1043669591 8:82865417-82865439 TAGGTTCACCTGGATAATGTAGG No data
1043669586_1043669591 23 Left 1043669586 8:82865371-82865393 CCAGCTGGAAGTGGTTGTCCACT No data
Right 1043669591 8:82865417-82865439 TAGGTTCACCTGGATAATGTAGG No data
1043669585_1043669591 24 Left 1043669585 8:82865370-82865392 CCCAGCTGGAAGTGGTTGTCCAC No data
Right 1043669591 8:82865417-82865439 TAGGTTCACCTGGATAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043669591 Original CRISPR TAGGTTCACCTGGATAATGT AGG Intergenic
No off target data available for this crispr