ID: 1043682616

View in Genome Browser
Species Human (GRCh38)
Location 8:83048708-83048730
Sequence GCCATTGAGTCCAAAGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043682611_1043682616 15 Left 1043682611 8:83048670-83048692 CCGCTTCATGATTCAATGTTTCC No data
Right 1043682616 8:83048708-83048730 GCCATTGAGTCCAAAGTTCAGGG No data
1043682609_1043682616 26 Left 1043682609 8:83048659-83048681 CCAGCCTAAAGCCGCTTCATGAT No data
Right 1043682616 8:83048708-83048730 GCCATTGAGTCCAAAGTTCAGGG No data
1043682614_1043682616 -6 Left 1043682614 8:83048691-83048713 CCTGAAGGGAATGTCTAGCCATT No data
Right 1043682616 8:83048708-83048730 GCCATTGAGTCCAAAGTTCAGGG No data
1043682610_1043682616 22 Left 1043682610 8:83048663-83048685 CCTAAAGCCGCTTCATGATTCAA No data
Right 1043682616 8:83048708-83048730 GCCATTGAGTCCAAAGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043682616 Original CRISPR GCCATTGAGTCCAAAGTTCA GGG Intergenic
No off target data available for this crispr