ID: 1043684469

View in Genome Browser
Species Human (GRCh38)
Location 8:83069059-83069081
Sequence GACTTAACTCCTTTAGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043684463_1043684469 19 Left 1043684463 8:83069017-83069039 CCCCAGAAAGTAGCGGTAATTCA No data
Right 1043684469 8:83069059-83069081 GACTTAACTCCTTTAGCACAAGG No data
1043684464_1043684469 18 Left 1043684464 8:83069018-83069040 CCCAGAAAGTAGCGGTAATTCAT No data
Right 1043684469 8:83069059-83069081 GACTTAACTCCTTTAGCACAAGG No data
1043684465_1043684469 17 Left 1043684465 8:83069019-83069041 CCAGAAAGTAGCGGTAATTCATT No data
Right 1043684469 8:83069059-83069081 GACTTAACTCCTTTAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043684469 Original CRISPR GACTTAACTCCTTTAGCACA AGG Intergenic
No off target data available for this crispr