ID: 1043685251

View in Genome Browser
Species Human (GRCh38)
Location 8:83076560-83076582
Sequence GACCAAATGCTTTTTCCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043685248_1043685251 8 Left 1043685248 8:83076529-83076551 CCCACAATTAACATCATGCTTAA No data
Right 1043685251 8:83076560-83076582 GACCAAATGCTTTTTCCCTAAGG No data
1043685249_1043685251 7 Left 1043685249 8:83076530-83076552 CCACAATTAACATCATGCTTAAT No data
Right 1043685251 8:83076560-83076582 GACCAAATGCTTTTTCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043685251 Original CRISPR GACCAAATGCTTTTTCCCTA AGG Intergenic
No off target data available for this crispr