ID: 1043686802

View in Genome Browser
Species Human (GRCh38)
Location 8:83096598-83096620
Sequence GTTTATGGATATTCATCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043686798_1043686802 20 Left 1043686798 8:83096555-83096577 CCTTTGTAGCATTTCAGGTGAGT No data
Right 1043686802 8:83096598-83096620 GTTTATGGATATTCATCTATAGG No data
1043686800_1043686802 -8 Left 1043686800 8:83096583-83096605 CCATGATTCTTTAGAGTTTATGG No data
Right 1043686802 8:83096598-83096620 GTTTATGGATATTCATCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043686802 Original CRISPR GTTTATGGATATTCATCTAT AGG Intergenic
No off target data available for this crispr