ID: 1043694665

View in Genome Browser
Species Human (GRCh38)
Location 8:83203887-83203909
Sequence CAAAATGCTGATGGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043694661_1043694665 4 Left 1043694661 8:83203860-83203882 CCTAGAGACTTGTCGAATGACTT No data
Right 1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043694665 Original CRISPR CAAAATGCTGATGGTGATAT GGG Intergenic
No off target data available for this crispr