ID: 1043703311

View in Genome Browser
Species Human (GRCh38)
Location 8:83318264-83318286
Sequence CTAAGTATTGCCAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043703311_1043703315 -9 Left 1043703311 8:83318264-83318286 CCTTCTTCCCTGGCAATACTTAG No data
Right 1043703315 8:83318278-83318300 AATACTTAGGCCTCAGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043703311 Original CRISPR CTAAGTATTGCCAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr