ID: 1043704680

View in Genome Browser
Species Human (GRCh38)
Location 8:83333143-83333165
Sequence TATGAAATGAAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043704677_1043704680 16 Left 1043704677 8:83333104-83333126 CCTTTTACTCTCAATGAAAGGCA No data
Right 1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043704680 Original CRISPR TATGAAATGAAGAAGGAAGA GGG Intergenic
No off target data available for this crispr