ID: 1043706895

View in Genome Browser
Species Human (GRCh38)
Location 8:83361397-83361419
Sequence CAGAGCTACATCTTGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043706895_1043706897 9 Left 1043706895 8:83361397-83361419 CCCAGTTTCAAGATGTAGCTCTG No data
Right 1043706897 8:83361429-83361451 ACACATGTGTTTTACAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043706895 Original CRISPR CAGAGCTACATCTTGAAACT GGG (reversed) Intergenic
No off target data available for this crispr