ID: 1043707876

View in Genome Browser
Species Human (GRCh38)
Location 8:83376712-83376734
Sequence CTCAAAAAGAAGTACAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043707876_1043707878 0 Left 1043707876 8:83376712-83376734 CCATTGCTGTACTTCTTTTTGAG No data
Right 1043707878 8:83376735-83376757 TGGTGATTCTTTTACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043707876 Original CRISPR CTCAAAAAGAAGTACAGCAA TGG (reversed) Intergenic
No off target data available for this crispr