ID: 1043709743

View in Genome Browser
Species Human (GRCh38)
Location 8:83401848-83401870
Sequence TCTCAGTGTTACCACACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043709743_1043709747 26 Left 1043709743 8:83401848-83401870 CCATTAGTGTGGTAACACTGAGA No data
Right 1043709747 8:83401897-83401919 AGAGAAAAAAGTCAATATTTAGG No data
1043709743_1043709745 -2 Left 1043709743 8:83401848-83401870 CCATTAGTGTGGTAACACTGAGA No data
Right 1043709745 8:83401869-83401891 GAAGGCCAACATTAGTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043709743 Original CRISPR TCTCAGTGTTACCACACTAA TGG (reversed) Intergenic
No off target data available for this crispr