ID: 1043711699

View in Genome Browser
Species Human (GRCh38)
Location 8:83426999-83427021
Sequence GCCATACTAGTGAATAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043711695_1043711699 9 Left 1043711695 8:83426967-83426989 CCTTACAATTCCACCAGCCACTC No data
Right 1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG No data
1043711696_1043711699 -1 Left 1043711696 8:83426977-83426999 CCACCAGCCACTCGCAACGTGAG No data
Right 1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG No data
1043711694_1043711699 17 Left 1043711694 8:83426959-83426981 CCATTGCACCTTACAATTCCACC No data
Right 1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG No data
1043711698_1043711699 -8 Left 1043711698 8:83426984-83427006 CCACTCGCAACGTGAGCCATACT No data
Right 1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG No data
1043711697_1043711699 -4 Left 1043711697 8:83426980-83427002 CCAGCCACTCGCAACGTGAGCCA No data
Right 1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG No data
1043711693_1043711699 18 Left 1043711693 8:83426958-83426980 CCCATTGCACCTTACAATTCCAC No data
Right 1043711699 8:83426999-83427021 GCCATACTAGTGAATAGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043711699 Original CRISPR GCCATACTAGTGAATAGAGC CGG Intergenic
No off target data available for this crispr