ID: 1043714711

View in Genome Browser
Species Human (GRCh38)
Location 8:83467350-83467372
Sequence CTCTGGGATAGCAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043714705_1043714711 -6 Left 1043714705 8:83467333-83467355 CCCTCCTCATGGAGAACCTCTGG No data
Right 1043714711 8:83467350-83467372 CTCTGGGATAGCAGAGAAGAAGG No data
1043714709_1043714711 -10 Left 1043714709 8:83467337-83467359 CCTCATGGAGAACCTCTGGGATA No data
Right 1043714711 8:83467350-83467372 CTCTGGGATAGCAGAGAAGAAGG No data
1043714700_1043714711 29 Left 1043714700 8:83467298-83467320 CCTGGATGTTCAGGCACAAGTTT No data
Right 1043714711 8:83467350-83467372 CTCTGGGATAGCAGAGAAGAAGG No data
1043714707_1043714711 -7 Left 1043714707 8:83467334-83467356 CCTCCTCATGGAGAACCTCTGGG No data
Right 1043714711 8:83467350-83467372 CTCTGGGATAGCAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043714711 Original CRISPR CTCTGGGATAGCAGAGAAGA AGG Intergenic
No off target data available for this crispr