ID: 1043720091

View in Genome Browser
Species Human (GRCh38)
Location 8:83537121-83537143
Sequence GGAGCAGCAGGCAACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043720091_1043720097 17 Left 1043720091 8:83537121-83537143 CCTTCCAGGTTGCCTGCTGCTCC No data
Right 1043720097 8:83537161-83537183 ATTTGTTCTCCTATTTCCTTGGG No data
1043720091_1043720096 16 Left 1043720091 8:83537121-83537143 CCTTCCAGGTTGCCTGCTGCTCC No data
Right 1043720096 8:83537160-83537182 CATTTGTTCTCCTATTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043720091 Original CRISPR GGAGCAGCAGGCAACCTGGA AGG (reversed) Intergenic