ID: 1043720096

View in Genome Browser
Species Human (GRCh38)
Location 8:83537160-83537182
Sequence CATTTGTTCTCCTATTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043720094_1043720096 -5 Left 1043720094 8:83537142-83537164 CCAGCTCCAGTAATCTGTCATTT No data
Right 1043720096 8:83537160-83537182 CATTTGTTCTCCTATTTCCTTGG No data
1043720092_1043720096 12 Left 1043720092 8:83537125-83537147 CCAGGTTGCCTGCTGCTCCAGCT No data
Right 1043720096 8:83537160-83537182 CATTTGTTCTCCTATTTCCTTGG No data
1043720089_1043720096 22 Left 1043720089 8:83537115-83537137 CCCTGGCCTTCCAGGTTGCCTGC No data
Right 1043720096 8:83537160-83537182 CATTTGTTCTCCTATTTCCTTGG No data
1043720090_1043720096 21 Left 1043720090 8:83537116-83537138 CCTGGCCTTCCAGGTTGCCTGCT No data
Right 1043720096 8:83537160-83537182 CATTTGTTCTCCTATTTCCTTGG No data
1043720091_1043720096 16 Left 1043720091 8:83537121-83537143 CCTTCCAGGTTGCCTGCTGCTCC No data
Right 1043720096 8:83537160-83537182 CATTTGTTCTCCTATTTCCTTGG No data
1043720093_1043720096 4 Left 1043720093 8:83537133-83537155 CCTGCTGCTCCAGCTCCAGTAAT No data
Right 1043720096 8:83537160-83537182 CATTTGTTCTCCTATTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043720096 Original CRISPR CATTTGTTCTCCTATTTCCT TGG Intergenic