ID: 1043720097

View in Genome Browser
Species Human (GRCh38)
Location 8:83537161-83537183
Sequence ATTTGTTCTCCTATTTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043720089_1043720097 23 Left 1043720089 8:83537115-83537137 CCCTGGCCTTCCAGGTTGCCTGC No data
Right 1043720097 8:83537161-83537183 ATTTGTTCTCCTATTTCCTTGGG No data
1043720091_1043720097 17 Left 1043720091 8:83537121-83537143 CCTTCCAGGTTGCCTGCTGCTCC No data
Right 1043720097 8:83537161-83537183 ATTTGTTCTCCTATTTCCTTGGG No data
1043720095_1043720097 -10 Left 1043720095 8:83537148-83537170 CCAGTAATCTGTCATTTGTTCTC No data
Right 1043720097 8:83537161-83537183 ATTTGTTCTCCTATTTCCTTGGG No data
1043720094_1043720097 -4 Left 1043720094 8:83537142-83537164 CCAGCTCCAGTAATCTGTCATTT No data
Right 1043720097 8:83537161-83537183 ATTTGTTCTCCTATTTCCTTGGG No data
1043720093_1043720097 5 Left 1043720093 8:83537133-83537155 CCTGCTGCTCCAGCTCCAGTAAT No data
Right 1043720097 8:83537161-83537183 ATTTGTTCTCCTATTTCCTTGGG No data
1043720090_1043720097 22 Left 1043720090 8:83537116-83537138 CCTGGCCTTCCAGGTTGCCTGCT No data
Right 1043720097 8:83537161-83537183 ATTTGTTCTCCTATTTCCTTGGG No data
1043720092_1043720097 13 Left 1043720092 8:83537125-83537147 CCAGGTTGCCTGCTGCTCCAGCT No data
Right 1043720097 8:83537161-83537183 ATTTGTTCTCCTATTTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043720097 Original CRISPR ATTTGTTCTCCTATTTCCTT GGG Intergenic