ID: 1043727528 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:83629533-83629555 |
Sequence | AATCTGAGGCAACTATGGAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1043727528_1043727535 | 28 | Left | 1043727528 | 8:83629533-83629555 | CCAATCCATAGTTGCCTCAGATT | No data | ||
Right | 1043727535 | 8:83629584-83629606 | AGGCTGTGAAACAGCAAAAATGG | No data | ||||
1043727528_1043727533 | 8 | Left | 1043727528 | 8:83629533-83629555 | CCAATCCATAGTTGCCTCAGATT | No data | ||
Right | 1043727533 | 8:83629564-83629586 | CCCTAATGCAACAGTGGCTGAGG | No data | ||||
1043727528_1043727531 | 2 | Left | 1043727528 | 8:83629533-83629555 | CCAATCCATAGTTGCCTCAGATT | No data | ||
Right | 1043727531 | 8:83629558-83629580 | CTAGAGCCCTAATGCAACAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1043727528 | Original CRISPR | AATCTGAGGCAACTATGGAT TGG (reversed) | Intergenic | ||