ID: 1043727528

View in Genome Browser
Species Human (GRCh38)
Location 8:83629533-83629555
Sequence AATCTGAGGCAACTATGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043727528_1043727535 28 Left 1043727528 8:83629533-83629555 CCAATCCATAGTTGCCTCAGATT No data
Right 1043727535 8:83629584-83629606 AGGCTGTGAAACAGCAAAAATGG No data
1043727528_1043727533 8 Left 1043727528 8:83629533-83629555 CCAATCCATAGTTGCCTCAGATT No data
Right 1043727533 8:83629564-83629586 CCCTAATGCAACAGTGGCTGAGG No data
1043727528_1043727531 2 Left 1043727528 8:83629533-83629555 CCAATCCATAGTTGCCTCAGATT No data
Right 1043727531 8:83629558-83629580 CTAGAGCCCTAATGCAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043727528 Original CRISPR AATCTGAGGCAACTATGGAT TGG (reversed) Intergenic