ID: 1043727529

View in Genome Browser
Species Human (GRCh38)
Location 8:83629538-83629560
Sequence TAGAGAATCTGAGGCAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043727529_1043727535 23 Left 1043727529 8:83629538-83629560 CCATAGTTGCCTCAGATTCTCTA No data
Right 1043727535 8:83629584-83629606 AGGCTGTGAAACAGCAAAAATGG No data
1043727529_1043727533 3 Left 1043727529 8:83629538-83629560 CCATAGTTGCCTCAGATTCTCTA No data
Right 1043727533 8:83629564-83629586 CCCTAATGCAACAGTGGCTGAGG No data
1043727529_1043727531 -3 Left 1043727529 8:83629538-83629560 CCATAGTTGCCTCAGATTCTCTA No data
Right 1043727531 8:83629558-83629580 CTAGAGCCCTAATGCAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043727529 Original CRISPR TAGAGAATCTGAGGCAACTA TGG (reversed) Intergenic
No off target data available for this crispr