ID: 1043727533

View in Genome Browser
Species Human (GRCh38)
Location 8:83629564-83629586
Sequence CCCTAATGCAACAGTGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043727529_1043727533 3 Left 1043727529 8:83629538-83629560 CCATAGTTGCCTCAGATTCTCTA No data
Right 1043727533 8:83629564-83629586 CCCTAATGCAACAGTGGCTGAGG No data
1043727527_1043727533 13 Left 1043727527 8:83629528-83629550 CCACTCCAATCCATAGTTGCCTC No data
Right 1043727533 8:83629564-83629586 CCCTAATGCAACAGTGGCTGAGG No data
1043727528_1043727533 8 Left 1043727528 8:83629533-83629555 CCAATCCATAGTTGCCTCAGATT No data
Right 1043727533 8:83629564-83629586 CCCTAATGCAACAGTGGCTGAGG No data
1043727530_1043727533 -6 Left 1043727530 8:83629547-83629569 CCTCAGATTCTCTAGAGCCCTAA No data
Right 1043727533 8:83629564-83629586 CCCTAATGCAACAGTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043727533 Original CRISPR CCCTAATGCAACAGTGGCTG AGG Intergenic
No off target data available for this crispr