ID: 1043728478

View in Genome Browser
Species Human (GRCh38)
Location 8:83644282-83644304
Sequence GAGGTAGTGCTGCCTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043728474_1043728478 -10 Left 1043728474 8:83644269-83644291 CCCATGATATTAGGAGGTAGTGC No data
Right 1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG No data
1043728471_1043728478 -4 Left 1043728471 8:83644263-83644285 CCTAACCCCATGATATTAGGAGG No data
Right 1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG No data
1043728467_1043728478 21 Left 1043728467 8:83644238-83644260 CCCCTCAAAATTCACATGTGGAA No data
Right 1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG No data
1043728473_1043728478 -9 Left 1043728473 8:83644268-83644290 CCCCATGATATTAGGAGGTAGTG No data
Right 1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG No data
1043728466_1043728478 22 Left 1043728466 8:83644237-83644259 CCCCCTCAAAATTCACATGTGGA No data
Right 1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG No data
1043728469_1043728478 19 Left 1043728469 8:83644240-83644262 CCTCAAAATTCACATGTGGAAAT No data
Right 1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG No data
1043728468_1043728478 20 Left 1043728468 8:83644239-83644261 CCCTCAAAATTCACATGTGGAAA No data
Right 1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043728478 Original CRISPR GAGGTAGTGCTGCCTTTGGG AGG Intergenic
No off target data available for this crispr