ID: 1043738460

View in Genome Browser
Species Human (GRCh38)
Location 8:83776057-83776079
Sequence TATCCTCTTTGATGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043738460_1043738464 2 Left 1043738460 8:83776057-83776079 CCCCCAGGACATCAAAGAGGATA No data
Right 1043738464 8:83776082-83776104 ATAAAATAAAACCCAACCAAAGG No data
1043738460_1043738469 25 Left 1043738460 8:83776057-83776079 CCCCCAGGACATCAAAGAGGATA No data
Right 1043738469 8:83776105-83776127 ATAGCAGCTTCAAAGATTGAGGG No data
1043738460_1043738468 24 Left 1043738460 8:83776057-83776079 CCCCCAGGACATCAAAGAGGATA No data
Right 1043738468 8:83776104-83776126 GATAGCAGCTTCAAAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043738460 Original CRISPR TATCCTCTTTGATGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr