ID: 1043750298

View in Genome Browser
Species Human (GRCh38)
Location 8:83926263-83926285
Sequence CAGGAAGACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043750298_1043750300 7 Left 1043750298 8:83926263-83926285 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 1043750300 8:83926293-83926315 TTTCAAGTCTTGCTTAGTCTTGG No data
1043750298_1043750302 19 Left 1043750298 8:83926263-83926285 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 1043750302 8:83926305-83926327 CTTAGTCTTGGATTTTTAATGGG No data
1043750298_1043750301 18 Left 1043750298 8:83926263-83926285 CCTCTCTGCAGCTGGTCTTCCTG No data
Right 1043750301 8:83926304-83926326 GCTTAGTCTTGGATTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043750298 Original CRISPR CAGGAAGACCAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr