ID: 1043758396

View in Genome Browser
Species Human (GRCh38)
Location 8:84032311-84032333
Sequence CTCTGGGGCTCTGCAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043758382_1043758396 19 Left 1043758382 8:84032269-84032291 CCCCAGACCTAGGAGCTCCCTGG No data
Right 1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG No data
1043758388_1043758396 12 Left 1043758388 8:84032276-84032298 CCTAGGAGCTCCCTGGGTCAGGG No data
Right 1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG No data
1043758384_1043758396 18 Left 1043758384 8:84032270-84032292 CCCAGACCTAGGAGCTCCCTGGG No data
Right 1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG No data
1043758379_1043758396 30 Left 1043758379 8:84032258-84032280 CCCTTCAGGGACCCCAGACCTAG No data
Right 1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG No data
1043758391_1043758396 1 Left 1043758391 8:84032287-84032309 CCTGGGTCAGGGCTGTGACAACC No data
Right 1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG No data
1043758386_1043758396 17 Left 1043758386 8:84032271-84032293 CCAGACCTAGGAGCTCCCTGGGT No data
Right 1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG No data
1043758390_1043758396 2 Left 1043758390 8:84032286-84032308 CCCTGGGTCAGGGCTGTGACAAC No data
Right 1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG No data
1043758380_1043758396 29 Left 1043758380 8:84032259-84032281 CCTTCAGGGACCCCAGACCTAGG No data
Right 1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043758396 Original CRISPR CTCTGGGGCTCTGCAGCTTC TGG Intergenic
No off target data available for this crispr