ID: 1043761038

View in Genome Browser
Species Human (GRCh38)
Location 8:84068634-84068656
Sequence GAGCTGGAGGCCATCATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043761038_1043761041 -3 Left 1043761038 8:84068634-84068656 CCTATGATGATGGCCTCCAGCTC No data
Right 1043761041 8:84068654-84068676 CTCCATCCATATTGTTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043761038 Original CRISPR GAGCTGGAGGCCATCATCAT AGG (reversed) Intergenic
No off target data available for this crispr