ID: 1043764238

View in Genome Browser
Species Human (GRCh38)
Location 8:84109399-84109421
Sequence ATGAAAAAGAAAAATAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043764238_1043764242 6 Left 1043764238 8:84109399-84109421 CCTTCCTTATTTTTCTTTTTCAT No data
Right 1043764242 8:84109428-84109450 TGTCCTCTTGGTTTAAGCATAGG No data
1043764238_1043764240 -6 Left 1043764238 8:84109399-84109421 CCTTCCTTATTTTTCTTTTTCAT No data
Right 1043764240 8:84109416-84109438 TTTCATCCATCATGTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043764238 Original CRISPR ATGAAAAAGAAAAATAAGGA AGG (reversed) Intergenic
No off target data available for this crispr