ID: 1043769743

View in Genome Browser
Species Human (GRCh38)
Location 8:84183416-84183438
Sequence CAGGCAGCGGGGAAGGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043769743_1043769752 17 Left 1043769743 8:84183416-84183438 CCTCGGTCCTTCCCCGCTGCCTG 0: 1
1: 0
2: 4
3: 34
4: 318
Right 1043769752 8:84183456-84183478 GAGTCACGTGTCAGTGCCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 121
1043769743_1043769748 -10 Left 1043769743 8:84183416-84183438 CCTCGGTCCTTCCCCGCTGCCTG 0: 1
1: 0
2: 4
3: 34
4: 318
Right 1043769748 8:84183429-84183451 CCGCTGCCTGCAAGTCAGCCTGG 0: 1
1: 0
2: 0
3: 23
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043769743 Original CRISPR CAGGCAGCGGGGAAGGACCG AGG (reversed) Intronic
900088652 1:909926-909948 CAGGCCGGGAGGAAGGACCGAGG + Intergenic
900109663 1:1000197-1000219 CAGCGAGCGGGGGAGGAGCGCGG - Intergenic
900214723 1:1475364-1475386 CAGGCAGAGGGGCAGGGCAGGGG - Intronic
900221933 1:1513714-1513736 CAGGCAGAGGGGCAGGGCAGGGG - Intronic
900424122 1:2568337-2568359 CCTGCAGCGGGGAGGAACCGGGG - Intergenic
900539065 1:3193780-3193802 CAGGCACCCGGGAAGGACTTGGG - Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900628069 1:3618547-3618569 CAGGCTGCGGGGAAGTAGCAGGG - Intergenic
900675942 1:3886312-3886334 TAGGCAGTGGGGCAGCACCGTGG - Intergenic
901195586 1:7438198-7438220 CAGGCAGCTGGGCAGGGCCTGGG + Intronic
901323769 1:8355323-8355345 CAGGCAGAGGGGGAGGAGCCTGG + Intronic
901672623 1:10865118-10865140 CAGGGAGGGGAGAAGGACCAGGG + Intergenic
901771416 1:11532116-11532138 CAGGCAGCAGGGAGGTACGGGGG - Intronic
902411624 1:16215227-16215249 CAGGCAGTGGTGAAGGACTCAGG - Intergenic
903349611 1:22710231-22710253 CAGGCACCGGGGCTGGGCCGGGG - Intergenic
903662604 1:24987501-24987523 CAGGAAGCGGCGAGGGAGCGGGG - Intergenic
904644404 1:31955090-31955112 CAGGCAGGGAGGAAGGAGCCAGG + Intergenic
906130475 1:43452569-43452591 CAGGTTGCGGAGAAGGACCGAGG - Exonic
906293600 1:44635686-44635708 AAGGGAGCGGGGAAGGAAGGTGG - Intronic
907122909 1:52023269-52023291 CAGGCAGCTGTGAAGAACTGAGG - Intronic
907243002 1:53090933-53090955 CCGGCAGGAGGTAAGGACCGCGG + Intronic
907331958 1:53677364-53677386 CAGGCAGTGGGGATGGCGCGGGG + Intronic
908977797 1:69919862-69919884 CAGGCAGCGGGGGAACCCCGAGG - Intronic
912383474 1:109260036-109260058 GATGCAGCGGGGAAGGAGTGGGG - Intronic
912437111 1:109669389-109669411 CAAGATGCGGGGAGGGACCGTGG + Intronic
916314005 1:163427499-163427521 GGGGCAGTGGGGAAGGACCGAGG - Intergenic
916443199 1:164847381-164847403 CAGGCAGCAGGGAAGGACACGGG + Exonic
918485112 1:185020623-185020645 CAAGCAGTGGTTAAGGACCGTGG + Intergenic
919807921 1:201391752-201391774 CAGGCAGAGGGAAGGTACCGAGG + Intronic
920250263 1:204618409-204618431 CAGGCAGGGACGAAGGACAGGGG - Exonic
920378764 1:205523543-205523565 CAGACAGCGGGGAGGAGCCGGGG + Exonic
923042891 1:230332646-230332668 GAAGCAGCGGGGAAGCAGCGAGG - Intronic
923226098 1:231940165-231940187 CAGAGAGAGGGGAAGGACAGAGG - Intronic
1064534716 10:16346752-16346774 CAGACAGAGGGGAAGGTCTGAGG - Intergenic
1066650619 10:37651605-37651627 CAGGCAGAGGAGAAGCCCCGCGG + Intergenic
1067062556 10:43085277-43085299 CAAACAGCGGGGAAGCACAGGGG + Intronic
1067481529 10:46602578-46602600 CAGGAAGCTGGGAAGGAATGGGG + Intergenic
1067613223 10:47739151-47739173 CAGGAAGCTGGGAAGGAATGGGG - Intergenic
1070540245 10:77410412-77410434 CAGGCAGCAGGGAGGGGCCCTGG - Intronic
1070600921 10:77865726-77865748 CAGGAAGCGGGGGAGGGCCTCGG + Intronic
1070976418 10:80609338-80609360 AAGGCAGAGGGGAAGGAAAGAGG - Intronic
1071628634 10:87199255-87199277 CAGGAAGCTGGGAAGGAATGGGG - Intergenic
1073190369 10:101646582-101646604 GAGGCAGCCGGGAAGGCCAGGGG + Intronic
1074137915 10:110644120-110644142 CAGGAAGCGGGGAGGGAGCGCGG - Intergenic
1074203284 10:111258606-111258628 CAGGCAGCGGGGCCAGACTGTGG - Intergenic
1074785283 10:116834029-116834051 CAGGCAAAGGGGAAGGACTTGGG + Intergenic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1075762931 10:124870370-124870392 CAAGGAGCGGGGAAGGAAGGAGG + Intergenic
1076009798 10:126978858-126978880 AAGGCAGAGTGGAAGGACCCTGG - Intronic
1076193785 10:128500636-128500658 CAGGCAGCGGGAGGGGAGCGAGG - Intergenic
1076441705 10:130484999-130485021 CAGGCACAGAGGAAGGACTGCGG - Intergenic
1076557092 10:131333590-131333612 CAGGCAGCCGGGCATGACCTTGG - Intergenic
1076706460 10:132304767-132304789 CAGGCAGTGAGGCAGGACCAGGG - Intronic
1076799657 10:132814715-132814737 CAGTCAGGGGGGATGGTCCGGGG + Exonic
1077329930 11:1979742-1979764 CAGGCAGCTGTGAGGTACCGGGG - Intronic
1077342226 11:2031231-2031253 CAGGCAGCGGGCCGGGACCTGGG + Intergenic
1077383453 11:2258096-2258118 CAGGCAGGGATGAAGGACTGAGG + Intergenic
1077663750 11:4091111-4091133 CAGGCAGGTGGGAAGGAGAGAGG - Intronic
1078413718 11:11148422-11148444 CAGGCAGCAGGGAGGTACCTCGG - Intergenic
1079005524 11:16789057-16789079 CAGGCAGCGGGGCAGGGACAGGG - Exonic
1080641716 11:34162307-34162329 CAGGCAGGGTGGAGGGCCCGAGG + Intronic
1081197879 11:40183773-40183795 AAGGCAGAGGGTAAGGACTGAGG - Intronic
1081632946 11:44701757-44701779 CAGGCAGAGGGGAGGGTCCTGGG - Intergenic
1083221730 11:61257210-61257232 TGGGCAGCGGGGAAGGAGCAGGG - Intergenic
1083252131 11:61475220-61475242 AAGGCAGAGGGGAAGGACCTTGG + Intronic
1083258065 11:61508764-61508786 GAGGCAACGGGGGAGGCCCGAGG + Intergenic
1083824135 11:65188703-65188725 CTGGCGGCGGGGGAGCACCGCGG + Exonic
1084198589 11:67540712-67540734 CAGGCTGCTGGGAATGACCCAGG + Intergenic
1084266244 11:68006822-68006844 CAGGCACCTTGGAAGCACCGTGG + Intergenic
1084947118 11:72644100-72644122 CAGGCAGGAGGGAAGGATCTGGG - Intronic
1084952466 11:72674249-72674271 CAGGCAGCGGGGACAGGGCGAGG - Exonic
1085532228 11:77198649-77198671 CAGACAGAGGGGAAGGAGAGGGG + Intronic
1089283855 11:117393232-117393254 CAGCCAGGTGGGAAGGACCCCGG - Intronic
1089411927 11:118251224-118251246 CAGGCAGCTGGGAGGGATCGGGG + Intronic
1089581329 11:119483481-119483503 GAGACAGCTGGGAAGGACCCAGG + Intergenic
1202812908 11_KI270721v1_random:34921-34943 CAGGCAGCTGTGAGGTACCGGGG - Intergenic
1202825212 11_KI270721v1_random:86420-86442 CAGGCAGCGGGCCGGGACCTGGG + Intergenic
1092241540 12:6839131-6839153 CAGGGAGCAGGTAAGGAGCGGGG + Exonic
1092749197 12:11702577-11702599 CAGGCAGTGGGGAAGGGCCATGG - Intronic
1092770425 12:11891684-11891706 CAGGCAGGGCGGGAGGACAGAGG - Exonic
1093199807 12:16172910-16172932 CAGGCAGCGGGATAGAACCCTGG + Intergenic
1096191502 12:49623271-49623293 CAGGCAGCGGGGAGAGGCAGAGG + Intronic
1097040923 12:56155466-56155488 CAGGCAGTGGCCAAGAACCGAGG + Exonic
1101331130 12:103758702-103758724 CAGGGAGTGGGGAAGAACCAGGG + Intronic
1101600322 12:106204077-106204099 AAGGCAGAGGGGAAGCAACGTGG - Intergenic
1101750442 12:107579034-107579056 GAGGCAGCGGGTAAGGCCAGAGG + Intronic
1102745448 12:115245053-115245075 AGGGCAGCGGGGAAGAACTGGGG + Intergenic
1102913676 12:116737566-116737588 CAGGGAGAGGGGAAGGAAGGAGG + Intronic
1103597380 12:122031938-122031960 CAGGCAGGGGGGAATGGCCCAGG - Intronic
1103809434 12:123601941-123601963 CAGGCGGCGGGGCAGGCCTGGGG - Intergenic
1104437487 12:128767381-128767403 CAGGCAGGGGGGAGGGAGGGAGG + Intergenic
1104715942 12:131016287-131016309 CGGGCAGGGGGGAAGGGCAGTGG - Intronic
1108449216 13:50543915-50543937 CAGGCAGCGGGGCACGACGCCGG - Intronic
1108484374 13:50909815-50909837 CAGGCAACGGGAAGGGGCCGCGG - Exonic
1112771801 13:102800490-102800512 CGGGCAGAGAGGAAGGAGCGCGG - Intronic
1113378963 13:109786188-109786210 CAGGCGGTGGGGAAGGTCCGGGG + Exonic
1113724390 13:112587704-112587726 CAGGGAGCCGGGGAGGACAGCGG - Intronic
1113766722 13:112886087-112886109 GAGCCAGCTGGGAAGGGCCGCGG + Exonic
1114450114 14:22819828-22819850 CCGGCAGCGGGGAGGGGCCAGGG + Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115030163 14:28785272-28785294 CAGGCTTCGGGGAAGGAGGGAGG + Intronic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1116957856 14:50943289-50943311 GAGGCAGTGGGGAAGGACTGGGG - Intronic
1117047630 14:51828869-51828891 CAGGCAGCGGGGAGGTAGTGGGG - Intronic
1117548677 14:56812584-56812606 CTGGCAGAGGGGAAGGCCGGAGG + Intergenic
1120991899 14:90384100-90384122 TAGGTAGAGGCGAAGGACCGGGG + Intergenic
1122183451 14:99971852-99971874 CTAGCTGCGGGGAAGGGCCGCGG - Intronic
1122503271 14:102215905-102215927 CAGGCAGGGGGGTAGGCCTGCGG - Intronic
1122623174 14:103071158-103071180 CATGCAGCAGGGAAGGAGCCAGG - Intergenic
1122707065 14:103628485-103628507 CGGGCAAAGGGGAAGGGCCGGGG - Intronic
1122898753 14:104773419-104773441 CAGGCAGGGGGGCAGGGCCCTGG - Intronic
1122940951 14:104981161-104981183 CAGGCTGAGGGGCAGGACCAGGG - Intergenic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1124667817 15:31609070-31609092 GAGGCAGCGGGAAAGGCCCTGGG + Intronic
1125768652 15:42151031-42151053 CAGGGAGCGGGGAGGGAGAGGGG + Intronic
1127310409 15:57747112-57747134 AGGGCAGCGGGAATGGACCGTGG - Intronic
1127932736 15:63607814-63607836 CAGGAAGAGGGGAAGGCCTGTGG - Intergenic
1128511011 15:68313916-68313938 CAGGCAGCGGGAAGGGTCTGAGG + Intronic
1129692229 15:77720360-77720382 CAGGCAGAGGGGCAGGTGCGTGG - Intronic
1130140929 15:81225658-81225680 CAAGCAGCTGGGAATGATCGAGG + Exonic
1130957710 15:88639136-88639158 CAGGCTGCGGGGCAGGCCAGAGG + Intronic
1131354995 15:91737423-91737445 CAGGCAGAGGGGAAAGACACTGG + Intergenic
1132597641 16:760629-760651 CAGGCAGCGGGCCAGGCCTGGGG - Intronic
1132654553 16:1036445-1036467 CTGGGAGCGGGGAGGGACCCAGG + Intergenic
1132701848 16:1225342-1225364 CAGGCAGGGCGGGAGGACGGAGG + Intergenic
1132730000 16:1356492-1356514 CAGGCGGAGGGGAGGGGCCGTGG + Intronic
1136124983 16:28172553-28172575 CAGGCAGGTGGGAAGGAAAGCGG + Intronic
1136296892 16:29308969-29308991 CAGGCAGAGGGGATGGGCAGAGG - Intergenic
1136419565 16:30123262-30123284 CAGGCAGGCGGGAAGGGGCGGGG - Exonic
1136687436 16:32003494-32003516 CAGGCAACGGGGAGGGCCCTGGG - Intergenic
1136788050 16:32947045-32947067 CAGGCAACGGGGAGGGCCCTGGG - Intergenic
1136881735 16:33906744-33906766 CAGGCAACGGGGAGGGCCCTGGG + Intergenic
1137391584 16:48085862-48085884 CAGGCACCAGGGAAAGACCAGGG + Intronic
1140714039 16:77705964-77705986 CAGGCAGCGGGGAGGCACTGGGG - Intergenic
1141461097 16:84179327-84179349 GAGGCAGCAGGGCAGGACCTCGG - Exonic
1141618253 16:85222140-85222162 CAGGGAGCGGGGAGGGGCAGTGG - Intergenic
1141681176 16:85544861-85544883 CAGGCAGCAGAACAGGACCGCGG + Intergenic
1142058466 16:88015156-88015178 CAGGCAGAGGGGACGGGCAGAGG - Intronic
1142058490 16:88015258-88015280 CAGGCAGAGGGCATGGACAGAGG - Intronic
1142409915 16:89910769-89910791 CAGGGAGCAGGGAAGGACCAAGG + Intronic
1203090275 16_KI270728v1_random:1208702-1208724 CAGGCAACGGGGAGGGCCCTGGG - Intergenic
1143697172 17:8629877-8629899 CCGGCGCCGGGGAAGGAGCGCGG - Intronic
1143785082 17:9249837-9249859 CAGGTAGCGGGGAAGGAGTGAGG - Intergenic
1144237264 17:13273839-13273861 CAGGCAGAAGGGAAAGACAGAGG - Intergenic
1144429019 17:15173641-15173663 CAGGCAGTGGGGAAGCTCTGTGG + Intergenic
1144682299 17:17204163-17204185 CAGGCCGCGGGGAGGGGACGGGG - Intronic
1145012819 17:19379200-19379222 CAGACAGCCGGGAAGGAAAGCGG + Intronic
1145310541 17:21698858-21698880 CAGGCAGTGGGGAGAGAGCGCGG - Intronic
1146132556 17:30291724-30291746 CCGGCGGCGGGGAAGGCCGGGGG - Intronic
1146619882 17:34389062-34389084 CAGGGAGAGGGGAAGGAGCATGG + Intergenic
1146724595 17:35147343-35147365 GAGGGAGCGGGGAAGGAACAGGG - Intergenic
1147148416 17:38499163-38499185 CAGGCAACGGGGAGGGCCCTGGG - Intronic
1147383860 17:40070705-40070727 CAGGCAGAGGGGAAGGGGAGAGG + Intronic
1147565964 17:41536604-41536626 AAGGCAGCAGGGAAGCACCCAGG - Intergenic
1147791340 17:43015895-43015917 CAGGAAGCGGGGAGGGGCAGGGG + Exonic
1148688530 17:49513790-49513812 CAGGCAGTGGGGAAGGGGTGGGG - Exonic
1150205269 17:63400037-63400059 CAGGCTGAGGGGAAGGAACTGGG + Intronic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151351482 17:73534589-73534611 AAGGCAGCAGGGAAGGCCGGTGG + Intronic
1151755727 17:76074421-76074443 CAGGCTGCAGGGAAGCGCCGAGG + Intronic
1152192469 17:78897060-78897082 CAGGCAGCGTGGAAGTGCCAGGG + Intronic
1152254121 17:79227569-79227591 CAGCCAGCCGGGAATGAGCGGGG - Intronic
1152573310 17:81129805-81129827 CAGCCATCCGGGAAGGTCCGAGG + Intronic
1152573491 17:81130501-81130523 CAGGCTGCGAGGAGGGGCCGAGG - Intronic
1152809603 17:82375322-82375344 CGGGCAGCGGGGGAGGCCGGGGG + Exonic
1154205543 18:12333841-12333863 CAGGGAGAGGGGAACGACCAGGG + Intronic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1158525016 18:58205546-58205568 CAGGCAGCTGGTAGGGACTGTGG + Intronic
1159836282 18:73340273-73340295 CATGAAGCGTGGAAGGACTGAGG + Intergenic
1160025069 18:75209662-75209684 CGGGCGGCGGGGCACGACCGGGG + Intergenic
1160231382 18:77052145-77052167 CAGGAACGGGGGAAGGAGCGGGG + Intronic
1160571152 18:79818423-79818445 CAGGCAGCGGGGGAGGAGGGAGG - Intergenic
1160720055 19:593109-593131 TGGGCAGCGAGGAAGAACCGGGG - Intronic
1160829187 19:1095062-1095084 CCGGCAGCGGGGAAGGGAGGGGG - Intronic
1160891395 19:1380570-1380592 CAGTGAGAGGGGAAGGACCCAGG - Intergenic
1160926068 19:1546459-1546481 GAGGCAGTGGGGTAGGAGCGAGG + Intergenic
1161041240 19:2111721-2111743 CAGGCAGCGAGGAGGCAGCGGGG - Exonic
1161118389 19:2512000-2512022 TCAGCAGCGGGGAAGGCCCGTGG + Exonic
1161241606 19:3226163-3226185 GAGGCCTTGGGGAAGGACCGGGG + Intronic
1161408465 19:4103152-4103174 CAGGCTGTGGGGAGGGGCCGAGG - Intronic
1162412309 19:10513956-10513978 CAGGCAGCGGCGCAGGCCCCCGG + Exonic
1163666578 19:18606505-18606527 CTGGCAGGGGGGAAGGAGTGGGG + Intronic
1164645435 19:29855706-29855728 CAGGCAGAGGGGAGGGAGTGGGG - Intergenic
1165425064 19:35740955-35740977 TAGGGAGCGGGGAAGGGGCGAGG - Intronic
1165745791 19:38229031-38229053 GAGGCAGCGGGGATGGAACTGGG + Intronic
1166099136 19:40560619-40560641 TAGGCAACTGGGAAGGACAGCGG - Intronic
1166294660 19:41883135-41883157 CAGGAAGCGGGGAGGGGCGGCGG + Intergenic
1166538845 19:43592737-43592759 CAGGCAGCGGGGAAGGTCCTGGG - Exonic
1167077289 19:47257357-47257379 CAGGAGGCGGGGAAAGAGCGTGG + Intronic
1167590719 19:50402952-50402974 CAGGCAGCGGGGACAGCCCCGGG + Intronic
1167768535 19:51499876-51499898 CAGCCAGAGGGGAAGGCCCGAGG - Intronic
1167861226 19:52285563-52285585 CAGGTATGGGGGAAGGACTGTGG + Intronic
925984013 2:9200582-9200604 CAGGCAGGGAGGAAGGGCAGGGG + Intergenic
927180780 2:20445556-20445578 CAGGAAGGTGGGAAGGAGCGGGG - Intergenic
927647653 2:24888209-24888231 CAGGCAATGGGGGAGGACCAGGG - Intronic
928029689 2:27767917-27767939 CAGGCAGAGTGGAAGGAACTGGG - Intergenic
929394456 2:41506908-41506930 CAGGAAGAGGGGAAGGGCAGCGG + Intergenic
929668481 2:43851878-43851900 AAGGCAGCAGGGGAGGAGCGGGG - Intronic
932192767 2:69754815-69754837 CAGCCAGAGGGGAAGGCCCCAGG - Intronic
932310002 2:70732111-70732133 CAGGCAGCAGGGGAGAACCCAGG + Intronic
932433767 2:71691070-71691092 CAGGCACCAGGGCAGGACAGGGG - Intergenic
932457519 2:71858769-71858791 CAGGGAGAGGGGAAGGGCCCAGG - Intergenic
932592401 2:73075281-73075303 CAGGCAGGTGGGAAAGACCCAGG + Exonic
934989818 2:98913388-98913410 CAGCCAGCGGGGCAGGTCCCTGG + Intronic
935514928 2:104024034-104024056 CAGGCAGCAGGGAATGATGGAGG + Intergenic
936500573 2:113062859-113062881 CATCCAGTGGGGGAGGACCGTGG - Exonic
937145316 2:119639231-119639253 CAGGCAGCGGGGACCCACGGAGG - Intronic
938080476 2:128367402-128367424 AAGGCAGTGGGGAAGGGCCTGGG + Intergenic
942642361 2:178073000-178073022 CAAGAAGCGGGGAAGGAACAAGG - Intronic
942794739 2:179804824-179804846 CAGGCAGTGGGTAAGAACAGAGG - Intronic
944675920 2:202034164-202034186 CAGGAGGCGGGGCAGCACCGCGG + Intergenic
944970302 2:204985178-204985200 CAGGCAGGAGGGAAGGAAGGAGG - Intronic
946966573 2:225042757-225042779 CAGGCTGCGGGGGAGGGCGGGGG + Intergenic
947766434 2:232640867-232640889 GAGGCAGCAGGGAAGGCCCTTGG + Intronic
948164739 2:235852273-235852295 GAGGCAGCGGAGAAGGGCCCGGG + Intronic
948979344 2:241485183-241485205 CAGGGAGTGAGGAAGGACCTTGG - Intronic
1169088314 20:2840741-2840763 ACGGCAGCTGGGAAGCACCGAGG - Exonic
1170268606 20:14498957-14498979 CAGTCAGCAGGGAGGGACTGAGG + Intronic
1170728158 20:18948236-18948258 CAGGCAGAGGGAAAGGTCTGAGG + Intergenic
1171344136 20:24452836-24452858 CAGGGAGCAGGGCAGGACCTAGG - Intergenic
1172276549 20:33682799-33682821 CACGCAGCTGTCAAGGACCGAGG + Intronic
1173163307 20:40668696-40668718 CAGGGAGCGGGGATGGGCTGTGG - Intergenic
1173952909 20:47007396-47007418 CAGGCAGAGGGGCAGGCCCTGGG + Intronic
1174287523 20:49483453-49483475 AAGGGGGCGGGGAAGGAGCGAGG - Intergenic
1174525121 20:51164406-51164428 CAGGCAGGGGAGAAAGACCCTGG - Intergenic
1174658358 20:52190849-52190871 CAGGCAGCTACGAAGGACAGCGG + Intronic
1175220047 20:57411654-57411676 CAGGCAGGCAGGAAGGGCCGGGG + Intergenic
1175605425 20:60308616-60308638 CTGGCAGCAGGGCAGGACCCTGG - Intergenic
1175710444 20:61216406-61216428 GAGGCACCAGGGAAGGACCATGG - Intergenic
1175994510 20:62806027-62806049 CAGGCAGCTGGGGAGGCCTGAGG - Intronic
1176005670 20:62861218-62861240 CGGGCGGCGGGGACGGAGCGAGG - Exonic
1176137285 20:63529807-63529829 GAGGCTGCGGGGAAGGCCCCAGG - Intronic
1176412274 21:6455456-6455478 CAGGCAGCGCAGAAATACCGCGG + Intergenic
1178878251 21:36429034-36429056 CAGACAGCGGGGACGGACCTGGG + Intergenic
1178900805 21:36596992-36597014 CAGGCAGCGGGGGTGGAGGGTGG + Intergenic
1179561779 21:42219869-42219891 GAGGCGGCGGCGAAGGCCCGGGG + Intronic
1179687768 21:43063778-43063800 CAGGCAGCGCAGAAATACCGCGG + Intronic
1180626106 22:17194489-17194511 CAGGCAGCGGGGCAGCACCCTGG - Intronic
1182722618 22:32415539-32415561 CAGGCAGCTGGAAAGGAGCATGG - Intronic
1183236702 22:36624210-36624232 GAGGCAGCGGGGATGGCCCGAGG + Intronic
1183629705 22:39025758-39025780 CAGGCAGGGGGGCAGGACGGAGG - Intronic
1183688554 22:39375646-39375668 CAGGCATCAGGGGTGGACCGGGG + Intronic
1183728862 22:39605804-39605826 CAGGCAGCGGGGAAGCATGCAGG + Intronic
1184248257 22:43246373-43246395 CAGGCAGCTGGGAAGCAGCTGGG + Intronic
1184782728 22:46657205-46657227 CAGGCCTCTGAGAAGGACCGAGG + Intronic
1184785445 22:46669373-46669395 CTGGCGGCGGGGAAGGAGGGTGG + Intronic
1184817581 22:46884022-46884044 CACTCAGCGAGGAAGGACTGAGG + Intronic
1184835698 22:47019778-47019800 AAGGCAGAGGGGAAGGATGGAGG - Intronic
1184835762 22:47020006-47020028 AAGGCAGCGGGGAAGGATGGAGG - Intronic
949454555 3:4224918-4224940 CAGGCAACTGGGAAGGATGGTGG - Intronic
950189269 3:10965389-10965411 CACCCAGCAGGGAAGGAGCGGGG - Intergenic
950906475 3:16543681-16543703 CAGGAACCTGGGAAGGACAGAGG - Intergenic
952223595 3:31350766-31350788 ATGGCAGCAAGGAAGGACCGAGG - Intergenic
952788356 3:37177038-37177060 AAGGCACTGGGGAAGGACCAGGG + Intronic
953349357 3:42202921-42202943 CAGCCAGAGGGGAGGGACGGAGG - Intronic
953398446 3:42591123-42591145 CAGGCGCCGGGGCAGGACCCCGG + Intronic
953606381 3:44415705-44415727 CAGGCAGTGGGGAGGGCCCTGGG - Intergenic
954035317 3:47848117-47848139 CAGGGAGTGGGGAAGCACTGAGG + Intronic
954334575 3:49908904-49908926 CAGCCAGCGGGCAGGGACTGTGG - Exonic
955238448 3:57160179-57160201 GAGGCAGCGGGGAATGAAGGAGG + Intronic
956963628 3:74433030-74433052 GAGGCAGTGGGGAAGGAAAGGGG + Intronic
958970040 3:100601132-100601154 CAAGCAGCGGGAAAGGCCCTGGG - Intergenic
961006982 3:123411908-123411930 CAGGCTGCGGGGATGGACACTGG - Intronic
961220192 3:125193585-125193607 CAGGCTGAGGGGCAGGACCACGG + Intronic
961340352 3:126213196-126213218 CTGGCTGCGGCGAAGGGCCGCGG - Intergenic
961396797 3:126599235-126599257 CAGGGAGAGGGGAAGGAAGGAGG - Intronic
963604777 3:147405011-147405033 CAGGCAGCGGGCAAAGGCCGGGG - Intronic
966770808 3:183501683-183501705 CAGGCAGCAGGCAGGGACCCAGG - Intronic
966931968 3:184681204-184681226 CAGGCAGTAGGGAATAACCGCGG - Intronic
967904194 3:194487072-194487094 CAGGAGGCGGGGAAGGGGCGGGG + Intronic
967980614 3:195063017-195063039 AAGGCAGCTGGGAAGGTCCGCGG + Intergenic
968525056 4:1052499-1052521 CTGGCAGGGGGGCAGGACCACGG - Intergenic
969354944 4:6619795-6619817 CAGGCACCAGGGGAGGACCTGGG + Intronic
969483935 4:7461307-7461329 AAGGCAGAGGGGAAGGAGGGCGG - Intronic
970367489 4:15374558-15374580 GAGGGAGCGGGCAAGGACCCCGG - Intronic
971169465 4:24218456-24218478 CAGTCAGCGAGGAAAGACGGAGG + Intergenic
973292478 4:48483798-48483820 GAGGGAACGGGGAAGGGCCGTGG - Exonic
975758444 4:77594593-77594615 CAGGCAGCTGGGCAGGTCCAGGG + Intronic
981026522 4:140082478-140082500 CAGGCAGGGAGGAAGGACGCTGG - Intronic
984863122 4:184257326-184257348 CAGGCAGTGGGGAGGGAGGGAGG + Intergenic
984863145 4:184257402-184257424 CAGGCAGTGGGGAGGGAGGGAGG + Intergenic
985661869 5:1161427-1161449 CAGGCTGCGGGGAGGGAGCTGGG - Intergenic
985778301 5:1856869-1856891 CAGGCAGGGGGCAAGGACAGAGG + Intergenic
987693568 5:21299632-21299654 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
989368625 5:40681912-40681934 CAGGGAGCGGGGAATGGACGCGG - Intronic
989603963 5:43226314-43226336 CAGGAGGCAGGGAAGGACAGAGG + Intronic
990816743 5:59794441-59794463 CAGGCTGCCGGGAAGCACCAGGG - Intronic
991412343 5:66357641-66357663 CAGTCACCTGGGAAGGACCTGGG + Intergenic
991746698 5:69749914-69749936 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991751007 5:69805328-69805350 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991798300 5:70329857-70329879 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991826076 5:70625226-70625248 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991830294 5:70680223-70680245 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991890635 5:71329173-71329195 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
996100246 5:119437736-119437758 CAGGGAAGGGGGAAGGACAGGGG + Intergenic
999655609 5:153807753-153807775 CAGGCAGAGGGGAGGGGCAGGGG - Intronic
1004897456 6:20162353-20162375 CAGGCAGATGGGAAGCTCCGAGG - Intronic
1006341293 6:33448579-33448601 CAGGCAGCTGGGAAGGTCTGAGG - Intronic
1007386326 6:41522666-41522688 CTAGCACCGGGGAGGGACCGAGG + Intergenic
1007397271 6:41585093-41585115 CATGCAGGGAGGGAGGACCGGGG - Intronic
1007661589 6:43490086-43490108 CAGGCTGCGGGGAAGGATGGAGG - Intronic
1011557603 6:88586796-88586818 CAGGCAGCTGGGAAGGGCGGGGG - Intergenic
1015849891 6:137560628-137560650 AAGGCAGCGGGAAAGGCCCTGGG - Intergenic
1016898601 6:149078711-149078733 CAGGCACGGGGGAAGGACACGGG - Intergenic
1017056069 6:150436450-150436472 CAGGCAGTGGGAAGGGACCCAGG + Intergenic
1018172181 6:161151998-161152020 TGGGCAGAGGGGAAGGACCTCGG + Intronic
1018789313 6:167134480-167134502 CAGGCATCAGGGAAGGAATGGGG + Intronic
1019048839 6:169167989-169168011 CAGGCAGCTGGGAAAGAGCTTGG - Intergenic
1019280205 7:195871-195893 CGGGCAGCGAGGAGGGACAGAGG + Intronic
1019441727 7:1050893-1050915 CAGGAGGCTGGGAAGGACAGGGG - Intronic
1019549226 7:1593948-1593970 CAGGAAGCAGGGAAGGAGGGAGG - Intergenic
1019660506 7:2221259-2221281 CAGGCAGCGGGGACAGCCCCCGG + Intronic
1021606755 7:22415966-22415988 CAGACAGAAGGGAAGGACCGGGG - Intergenic
1026171169 7:67955174-67955196 CAGGCAGCAGAGAAGGACCTGGG + Intergenic
1026798906 7:73385060-73385082 CAGGCTGTGGGAAAGGACTGGGG + Intergenic
1027224488 7:76235305-76235327 CAGGCCGCGGGGCGGGACTGGGG + Intronic
1029657554 7:101936979-101937001 CAGTCACCGGGGAAGGGCCTGGG + Intronic
1032015667 7:128379049-128379071 AAGGCAGAGGGGAAGGACCACGG + Intergenic
1032174318 7:129611577-129611599 CAGGCAGCGGAGAGGGCTCGCGG - Intergenic
1032324085 7:130910219-130910241 CAGGCAGAGCGGAAGGCCCTAGG + Intergenic
1032466624 7:132150012-132150034 CAGGCAGCAGGGAAGCCCCAGGG - Intronic
1034329432 7:150269675-150269697 CAGGCATCGTGGAATGAACGAGG + Intronic
1034668624 7:152840186-152840208 CAGGCATCGTGGAATGAACGAGG - Intronic
1035597105 8:866822-866844 CAGGGAGCGGGAAAGGCCCAGGG - Intergenic
1036089084 8:5645646-5645668 CAGGGAGAGGGGAATGACAGTGG - Intergenic
1036163068 8:6406830-6406852 CAGGCAGCGGGGGAGGAAGGAGG - Intronic
1036217347 8:6891726-6891748 CAGGAAGTGGGGTAGGACCCAGG + Intergenic
1037674379 8:21041305-21041327 CAGGCAGCGGGGAGGGGCGGGGG + Intergenic
1038276686 8:26127216-26127238 CAGGCACAGAGAAAGGACCGTGG - Intergenic
1038575904 8:28702580-28702602 CAGGTTGCGGGGAAGGGCGGGGG - Intronic
1038632820 8:29262601-29262623 CAGCTGGCGGGGAAGGAGCGAGG + Intronic
1039437945 8:37573547-37573569 CAGGCAGGGGTGAGGGACAGGGG - Intergenic
1039454286 8:37697259-37697281 CTGGGAGCGGAGAAGGACCCCGG + Exonic
1040342643 8:46448667-46448689 CAGGCAGAGGGGAAGCAGAGAGG - Intergenic
1043769743 8:84183416-84183438 CAGGCAGCGGGGAAGGACCGAGG - Intronic
1044629156 8:94262298-94262320 CAGGCGGCGGGCAAGGACGGCGG - Exonic
1048977457 8:139680884-139680906 CAGGCTGCTGGGCAGGACCATGG - Intronic
1049339570 8:142104795-142104817 CACGCAGCGTGGAAGGGCCATGG + Intergenic
1049368937 8:142254319-142254341 CAGGCAGCAGGGAGAGGCCGGGG - Intronic
1049710399 8:144060602-144060624 GAGGCAGCGGGGAAGGGCCGCGG + Intronic
1053157413 9:35791099-35791121 CAGGGAGCGGGCATGGTCCGCGG + Intergenic
1053157558 9:35791551-35791573 GAGGCAGCGGGGGAGGGGCGGGG + Intergenic
1056167994 9:83956975-83956997 CAGGCTGCGGGAAAGGAGAGGGG - Intronic
1057478682 9:95426920-95426942 CAGGAAGCGGGGCAGGAACCAGG - Intergenic
1059130908 9:111748681-111748703 CAGGCAGCTGGAAAGGAAGGAGG - Intronic
1061215479 9:129219282-129219304 AAAGGAGCGGGGAAGGACAGTGG + Intergenic
1061379070 9:130243553-130243575 CAGGCATCTGGGAGGGACCAGGG - Intergenic
1062542111 9:137046073-137046095 GAGGCAGCGGGGGAGGACGCAGG + Exonic
1189198989 X:39175591-39175613 AAGGCAGTGGGGAAGGAGAGAGG + Intergenic
1189302198 X:39960167-39960189 CAGGCAGCAGGGATGGAGGGCGG - Intergenic
1192220523 X:69194679-69194701 CAGGCTGGGGGGAAGAACAGAGG - Intergenic
1200062102 X:153488295-153488317 GAGGCAGAGGGGAAGGAGAGGGG - Intronic
1200092439 X:153642303-153642325 GAGGGAGCGGGGAGGGGCCGCGG - Intergenic
1200143371 X:153913139-153913161 CAGGCGGGAGGGGAGGACCGTGG + Intronic
1201602668 Y:15748327-15748349 CAGACAGTGGGGCAGGACAGTGG - Intergenic