ID: 1043773776

View in Genome Browser
Species Human (GRCh38)
Location 8:84238760-84238782
Sequence AGGAGTCAGCACATCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043773774_1043773776 -9 Left 1043773774 8:84238746-84238768 CCATCAAGCTTAGTAGGAGTCAG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1043773776 8:84238760-84238782 AGGAGTCAGCACATCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043773776 Original CRISPR AGGAGTCAGCACATCCATGT GGG Intronic
No off target data available for this crispr