ID: 1043774177

View in Genome Browser
Species Human (GRCh38)
Location 8:84243894-84243916
Sequence CAAAGGGAAATGCCAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 361}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043774177 Original CRISPR CAAAGGGAAATGCCAAAGAG AGG (reversed) Intronic
901044735 1:6389073-6389095 CCAAGGGAAAAGACAAAGAGGGG - Intronic
901174538 1:7289301-7289323 CAAAGGGAAATGAGCAGGAGGGG + Intronic
902209584 1:14895103-14895125 CAAAGGGCAAAGCCAGGGAGGGG - Intronic
903327886 1:22581686-22581708 TAAAAAGAAATGCCAAAGTGGGG + Intronic
903665671 1:25006110-25006132 CAAACGGAAATGCCTTTGAGGGG - Intergenic
904275213 1:29378859-29378881 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
904475068 1:30759501-30759523 CAAAGCCAACTCCCAAAGAGAGG + Intergenic
905852325 1:41283348-41283370 CAAAAGGAGATGCCAGAGAGGGG - Intergenic
905979125 1:42207517-42207539 CAATGGTAAATGTTAAAGAGGGG + Intronic
906737290 1:48142543-48142565 CAAAAGTACATGCCACAGAGTGG - Intergenic
906817550 1:48894473-48894495 CAAATGGAAATGCTAATGATTGG + Intronic
906865524 1:49414575-49414597 CAAAGGAATATGGCAAAGCGAGG + Intronic
906949520 1:50323173-50323195 CAAATGGAAATCCCAAACACTGG + Intergenic
908947733 1:69520607-69520629 CAAAGGGAATTTCCAAAATGTGG + Intergenic
910329435 1:86053701-86053723 CATAAGGAAATGCCAAAGAAGGG + Intronic
911357677 1:96842365-96842387 AAAAGGGAAATTGCAAAGAAAGG + Intergenic
911586901 1:99701888-99701910 AAAAGGAAAATGCTAGAGAGGGG - Intergenic
911694972 1:100880144-100880166 CAAAGGAAAATGTTAAAGACGGG - Intronic
912589661 1:110803652-110803674 CAAAGGGAAAGGACTAAGAGAGG + Intergenic
913471820 1:119195871-119195893 CAAAGGGAAATGTGACAGAGGGG + Intergenic
914769686 1:150673057-150673079 GAAAGGGAAATGCAAAATAAAGG + Intronic
916677590 1:167076729-167076751 AATATGCAAATGCCAAAGAGGGG - Intronic
917415192 1:174801984-174802006 AAAATGTAAATGCCAAAGAGAGG - Intronic
917524427 1:175774548-175774570 CAATGGCAATTGCTAAAGAGGGG + Intergenic
918390061 1:184050719-184050741 CCAAGCTAAATGCCAAAGAGAGG + Intergenic
918849857 1:189673243-189673265 CAAAGGAAAAAGAAAAAGAGTGG - Intergenic
919095861 1:193035305-193035327 CAAAGGTTAAAGACAAAGAGAGG + Intronic
920493038 1:206433258-206433280 CAATGGGAAATGGTAAGGAGTGG + Intronic
920793423 1:209114634-209114656 CATAGGAAAAAGCCATAGAGTGG + Intergenic
921241275 1:213186508-213186530 CAAAGGTCAAGGGCAAAGAGAGG - Intronic
921259461 1:213372566-213372588 CAAAGCGAAGTTCCCAAGAGAGG - Intergenic
921720215 1:218463101-218463123 CAATGGGAAATGCCACAGCGGGG - Intergenic
922768375 1:228167978-228168000 CAAAGGGAAAAGGACAAGAGAGG - Intronic
1063575074 10:7254344-7254366 CAAAGGGAGAAGGAAAAGAGAGG + Intronic
1067042120 10:42960515-42960537 CACAGGGAAGTGCTATAGAGAGG - Intergenic
1067377543 10:45741707-45741729 CAAAGGGCAATGCCTCACAGGGG + Intronic
1067885245 10:50082392-50082414 CAAAGGGCAATGCCTCACAGGGG + Intronic
1069239379 10:66120825-66120847 AAAAAGGAAAGTCCAAAGAGAGG + Intronic
1069330879 10:67291466-67291488 CAATGAGAAATGCTAGAGAGAGG - Intronic
1071265774 10:83963517-83963539 AAAAGGAACATGCCAAACAGAGG + Intergenic
1071302621 10:84267740-84267762 CAACAGGAAATGCCATAGGGAGG - Intergenic
1071400076 10:85260342-85260364 AAGAGGGAAATGCCAAAGAGTGG + Intergenic
1071626765 10:87179699-87179721 CATAGTGAAAAGCCAAATAGGGG - Intronic
1074058219 10:109941930-109941952 CAATGGGAAATGCCCAAGACTGG - Intronic
1074632790 10:115276585-115276607 CAAATGTTAATGGCAAAGAGAGG + Intronic
1074919822 10:117996012-117996034 CAAAGGCAAATGACAAAATGGGG - Intergenic
1075458113 10:122598106-122598128 CACAGGGACATGAAAAAGAGAGG - Intronic
1075906975 10:126089888-126089910 CAAAGGAAGAGGACAAAGAGAGG - Intronic
1076605281 10:131685416-131685438 CAAAGGGAAAGGGCTCAGAGAGG + Intergenic
1076687583 10:132205000-132205022 CAAAAGAAAATGCTAAGGAGGGG - Exonic
1078678139 11:13446282-13446304 CAAAGGGAAATTCCAAAACTGGG + Intronic
1080023609 11:27590732-27590754 CAAAGGGAAGTGACAAAGATGGG + Intergenic
1080062198 11:27968965-27968987 TAAAGGGAAATTCCAAATACAGG - Intergenic
1080104599 11:28498588-28498610 CAAAAGGAAAGGACAAATAGGGG - Intergenic
1080351321 11:31388330-31388352 CAAAGGTCAAGGACAAAGAGAGG + Intronic
1080606772 11:33870244-33870266 AAAAGGGAAAGGCGGAAGAGGGG - Intronic
1081001739 11:37682128-37682150 CAAAGGTCAAAGGCAAAGAGAGG - Intergenic
1081040369 11:38202446-38202468 CAAAGGTCAAAGGCAAAGAGAGG + Intergenic
1081147029 11:39574512-39574534 CAGAGGAAAATCCCAAATAGAGG + Intergenic
1081470259 11:43363349-43363371 CAAAATGAAGTGCCATAGAGTGG - Intronic
1081524946 11:43921238-43921260 CATAGGAAAATGCCAAAGGCTGG + Intergenic
1081549356 11:44097047-44097069 CAACTGGAAATGCCAAAGCTAGG - Intronic
1082210916 11:49499835-49499857 CAAAGGTCAAAGACAAAGAGAGG + Intergenic
1082767290 11:57180051-57180073 CAAAGGGAAATCACAGAGACAGG - Intergenic
1082933340 11:58631635-58631657 CAGAAGGAAATATCAAAGAGGGG + Intergenic
1083040683 11:59682420-59682442 CAAAGGTAAATGTCAAAGACAGG + Intergenic
1083124161 11:60546443-60546465 AAAAGGTAAAAGACAAAGAGAGG + Intergenic
1084278043 11:68066177-68066199 CAAAAGAAAATGCCAAAGTCTGG + Intronic
1084367564 11:68712594-68712616 AAAAGAGAAATAGCAAAGAGAGG + Intronic
1084522059 11:69669526-69669548 CAAAGGGAGATGCCAAAACGTGG + Intronic
1085250502 11:75140553-75140575 AAAAGGAAAGTGCCAAAGGGAGG + Intronic
1085898534 11:80668587-80668609 AAAAAGGAAAAGCAAAAGAGAGG - Intergenic
1086851093 11:91809898-91809920 CAAAGGACAAGGACAAAGAGAGG - Intergenic
1087330108 11:96770557-96770579 TAAATGCAAAAGCCAAAGAGAGG - Intergenic
1087730152 11:101769176-101769198 CATAGGGAACTGCCCAAGACTGG + Intronic
1087901467 11:103646264-103646286 CAATGGGGACTGCAAAAGAGGGG + Intergenic
1088012845 11:105023753-105023775 CACAGGGAAATACCAGAGGGAGG - Intergenic
1088582557 11:111330196-111330218 CAAGGAGCAATTCCAAAGAGAGG + Intergenic
1089627608 11:119761566-119761588 GAAAAGGAAATGCTAAACAGAGG - Intergenic
1090291973 11:125553662-125553684 CAAAGGGAAATCACAGGGAGAGG - Intergenic
1091495473 12:968642-968664 CAAAAGGAAAAGCCAGAGAATGG + Intronic
1091597240 12:1886383-1886405 GAAAGGGACATGCCCAAGATGGG + Intronic
1091660411 12:2379123-2379145 CAAAGGGACATTGCCAAGAGAGG - Intronic
1094471802 12:30808724-30808746 CAAAGGTCAATGACAAACAGAGG + Intergenic
1094801976 12:34047955-34047977 GCAAGGAAAATGCCACAGAGAGG + Intergenic
1095653906 12:44647130-44647152 TAGAGGGAAATGCCAAGGAGTGG + Intronic
1095758852 12:45803945-45803967 CAAAGTGGAATGCATAAGAGAGG - Intronic
1095776393 12:46015026-46015048 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
1096730150 12:53603540-53603562 CAAAGGGAGATCACAATGAGAGG + Intronic
1096760075 12:53834228-53834250 CAATGTTAAATGCCAAAGAGAGG + Intergenic
1097269246 12:57764332-57764354 CAAGAGGAAATGCCAAGGAAGGG - Intronic
1099013435 12:77319116-77319138 CAAAAGCAATTGCCAAATAGAGG + Intergenic
1099291384 12:80780563-80780585 CTAAGAAAAATGCTAAAGAGGGG + Intergenic
1102436939 12:112931405-112931427 GATAGGGAAATGGCATAGAGAGG - Intronic
1104748857 12:131225734-131225756 CAAGGAGAAATCCCAAAGAATGG - Intergenic
1104784266 12:131439830-131439852 CAAGGAGAAATCCCAAAGAATGG + Intergenic
1104868639 12:131977687-131977709 CAGAGGGAATGGACAAAGAGAGG - Intronic
1105502769 13:20987685-20987707 CAAGGGGAAAGGCGAAAGGGAGG + Intronic
1106778828 13:33035075-33035097 AAAAGGCAAATGCGAAAGAAGGG + Intronic
1107141281 13:37000691-37000713 CCACGGGAAATGCCAAGGTGGGG - Exonic
1108259514 13:48642742-48642764 AAAGGGGAAATGGCAAAGGGTGG - Intergenic
1108587775 13:51885742-51885764 CAAAGGGAAGTGCCTAGGAGGGG - Intergenic
1109038116 13:57292761-57292783 AAAAAGGAACTGACAAAGAGTGG + Intergenic
1109089672 13:58025215-58025237 TAAATGGAAATGAAAAAGAGAGG - Intergenic
1109249086 13:59996611-59996633 AAAAAGGTAATGACAAAGAGTGG + Intronic
1109372842 13:61446562-61446584 CAAAGGGGATGGACAAAGAGAGG + Intergenic
1109579713 13:64312552-64312574 CATAGGGAAAGGAAAAAGAGTGG + Intergenic
1110375117 13:74784502-74784524 GAAGGAGAAAAGCCAAAGAGTGG - Intergenic
1110726253 13:78827865-78827887 CAAAGAGAAATGCCAAAAGTTGG + Intergenic
1111003617 13:82218166-82218188 CAAAGGAAAAAGCCAAAGGACGG - Intergenic
1112925245 13:104666234-104666256 ATAAGGATAATGCCAAAGAGAGG + Intergenic
1113502734 13:110790588-110790610 CAAAGAGATATGGCAAAAAGAGG - Intergenic
1114270532 14:21098012-21098034 CAAAGGGAAGGGCCAACGGGGGG - Intronic
1114346304 14:21798923-21798945 AAAAGGGAAATCCAAAAGGGAGG + Intergenic
1114553612 14:23548765-23548787 AAGAGAGAAATGCCCAAGAGAGG - Intronic
1114903056 14:27089747-27089769 TAAAGGGAAAAGAGAAAGAGAGG + Intergenic
1115389007 14:32832672-32832694 CAAAGAGATATGCCCAACAGTGG - Exonic
1117440723 14:55756701-55756723 CAAAGAGGACTGTCAAAGAGAGG + Intergenic
1117715487 14:58575691-58575713 CAGAGGGAAATGGAAGAGAGAGG - Intergenic
1117770448 14:59128945-59128967 CAAAGGCTGATGCCACAGAGGGG + Intergenic
1119139319 14:72251397-72251419 GATAGGGAAATTCCAGAGAGAGG + Intronic
1119163834 14:72475729-72475751 CAAAAAAAAATTCCAAAGAGTGG + Intronic
1119943914 14:78671191-78671213 CAGAGGTCAGTGCCAAAGAGAGG + Intronic
1120232739 14:81857482-81857504 CAAAGGGAGATTCAACAGAGGGG + Intergenic
1121176606 14:91895282-91895304 CAAAGGGAAATGGCCAAGAAGGG + Intronic
1122656614 14:103265907-103265929 CAAATGTCAATGGCAAAGAGAGG - Intergenic
1124081192 15:26499729-26499751 CAAAGGTCAATGATAAAGAGAGG - Intergenic
1124795694 15:32775938-32775960 CAATGGGGAATGGCAATGAGTGG - Intronic
1125238285 15:37542129-37542151 CAAATGGAAATCAAAAAGAGTGG + Intergenic
1126204240 15:46025260-46025282 CAAAGTAAAATGTCAAAGTGAGG - Intergenic
1126440630 15:48684063-48684085 TAAAGGGAAATGCACAAGACTGG + Intergenic
1127024647 15:54790518-54790540 CAAAGAGAAATGCCAAATAATGG - Intergenic
1127124566 15:55799638-55799660 CAAAGGGAAAGACCACAGTGGGG + Intergenic
1127323953 15:57875835-57875857 CAAAGGTCAAGGACAAAGAGAGG + Intergenic
1127984061 15:64055012-64055034 CACAGGGAAAAGCAAAACAGAGG + Intronic
1128550875 15:68597171-68597193 CAAGGAGAAATGACAGAGAGAGG + Intronic
1128896690 15:71380093-71380115 CAAAGGCAAATTCCAAAGTTAGG + Intronic
1130078051 15:80707211-80707233 GAAAGGGAAATGGGAAAGTGTGG + Intronic
1131382997 15:91980045-91980067 CAAAAGGAAAAGCAACAGAGAGG + Intronic
1131660259 15:94506637-94506659 CAAAGGTAAAAGACAAAGGGAGG + Intergenic
1131801743 15:96076344-96076366 AAAAGGGAAATGTCGAGGAGCGG + Intergenic
1133521272 16:6560048-6560070 GAAAGGGAAATGGGAAAGTGTGG - Intronic
1134509556 16:14834950-14834972 GGCTGGGAAATGCCAAAGAGAGG + Intronic
1134697261 16:16233766-16233788 GGCTGGGAAATGCCAAAGAGAGG + Intronic
1134974585 16:18560908-18560930 GGCTGGGAAATGCCAAAGAGAGG - Intronic
1135102930 16:19622778-19622800 CAAATGTAAATACCCAAGAGTGG + Intronic
1135175211 16:20221746-20221768 CAGAGGGAAATGACAGAGAGAGG - Intergenic
1135198472 16:20415277-20415299 CAAAGGGAAATCCAAGAGTGTGG + Intronic
1135405028 16:22191252-22191274 CAAAAGGAGAAGCCAAAGGGTGG - Exonic
1135478946 16:22804583-22804605 CAAAGGAAAATATAAAAGAGTGG + Intergenic
1135740769 16:24973476-24973498 CAAACGAAAGTGCCAAAGACAGG - Intronic
1138176876 16:54908364-54908386 CTTAGGGAAATGCAAATGAGAGG + Intergenic
1138765062 16:59592219-59592241 CAAAGAGAAATCATAAAGAGCGG + Intergenic
1138974143 16:62183385-62183407 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
1139194723 16:64905647-64905669 CACAGCAAAATGCCACAGAGTGG - Intergenic
1139839626 16:69868024-69868046 GAGAGGAAACTGCCAAAGAGAGG + Intronic
1140328221 16:74026813-74026835 CACAGAGAAATGACAAAGAGAGG + Intergenic
1141224685 16:82103911-82103933 CACAGGGCAATGCTAAAGAGAGG - Intergenic
1142508019 17:377863-377885 CAAAGAAAAATGCCAAAAGGAGG + Intronic
1143197306 17:5085859-5085881 GAAAAGGAAAGGCCAGAGAGGGG + Intronic
1144408782 17:14978715-14978737 CTAAGGAAAATACCTAAGAGTGG + Intergenic
1145849881 17:28082491-28082513 CAAAGGGAACTGATAAAAAGGGG - Intronic
1146583050 17:34056949-34056971 CTGGGGGAAATGTCAAAGAGTGG + Intronic
1147563250 17:41521634-41521656 CCCAGGGAAATGCCAGGGAGAGG + Exonic
1148964831 17:51426142-51426164 CAAAGAAAAAGGGCAAAGAGGGG - Intergenic
1148972905 17:51499985-51500007 CCAAGGGCAATGCCCCAGAGAGG - Intergenic
1149804625 17:59604020-59604042 CAAAGGGAAATGAAAAATAAAGG + Intronic
1149827110 17:59838891-59838913 CAAAGGGAAATGACTAGAAGAGG + Intronic
1151496641 17:74462004-74462026 CAAAGGGCAGTGCCAGACAGAGG + Intergenic
1153145760 18:2029700-2029722 GAAATGGAAATGCCAAATAATGG + Intergenic
1154325845 18:13389783-13389805 GAAAGGGAAAGGCCAAACTGAGG + Intronic
1155744224 18:29331465-29331487 TAAAGCAAAATGCCAAAAAGAGG + Intergenic
1156449205 18:37257381-37257403 TAAGGAGAAATACCAAAGAGTGG + Intronic
1156757062 18:40540794-40540816 GAAATGGAAATTCCAGAGAGGGG + Intergenic
1158543289 18:58375493-58375515 CAGAGGGTAATGCCAGAGGGGGG - Intronic
1159804814 18:72943472-72943494 CCCAGGAAAATGCAAAAGAGTGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161441831 19:4296297-4296319 CAGAGGGAACTGGCACAGAGAGG + Intronic
1163110750 19:15159912-15159934 CAAAGGGAGATGGCCAAGGGTGG + Exonic
924996026 2:362200-362222 TAAAGGGACATGCGAAAGAAAGG + Intergenic
925170780 2:1749172-1749194 CAAAGGCACATGCCCAGGAGGGG - Intergenic
926890021 2:17631178-17631200 CAAAGGTAAATGAGAGAGAGAGG + Intronic
927152751 2:20205184-20205206 CAAAGGGCAATGCTGAGGAGAGG - Intronic
927381743 2:22487330-22487352 CAAAAGTAAGGGCCAAAGAGTGG - Intergenic
928347901 2:30517691-30517713 CAAAGGGAAGGGAGAAAGAGAGG + Intronic
928482223 2:31694146-31694168 CAAAGGGAAATCACCAACAGAGG - Intergenic
928766170 2:34648602-34648624 CAAAGAGAAATGATTAAGAGTGG - Intergenic
929331705 2:40690187-40690209 CAAAGGGAAATTCTAGACAGTGG + Intergenic
929674745 2:43915381-43915403 CAAAGGAAAATGCCTCAGAATGG + Intronic
930963797 2:57294971-57294993 CAAATGGAAGTGCCAAACTGTGG - Intergenic
932373229 2:71210677-71210699 CAAAGGTAAATTACAAATAGAGG + Intronic
932875791 2:75449867-75449889 CAAAAGGAAATGACAAAGGAAGG + Intergenic
932887652 2:75561467-75561489 GAAAGAGAAAGGCCAAACAGAGG - Intronic
933897594 2:86825372-86825394 CAAAGGGAATGGCCAAGGAGGGG - Intronic
934575301 2:95396823-95396845 CACAGGGAAATGGCCCAGAGAGG + Intergenic
935543294 2:104374827-104374849 GGAAGGAAAATGGCAAAGAGAGG + Intergenic
937834742 2:126460897-126460919 AAAAGGGACAGGCCAATGAGAGG - Intergenic
940248784 2:151650182-151650204 CAAAGACAAATGCCAAAAATAGG - Exonic
940743224 2:157535938-157535960 CATAGGGATATGCCGATGAGGGG - Intronic
942418963 2:175787866-175787888 CAAGGGAACATGCCAGAGAGGGG + Intergenic
942675791 2:178425606-178425628 CAAAGGGCAAGGACAAAGAAAGG - Intergenic
942882472 2:180878108-180878130 CAAAGTGACATCCCACAGAGTGG + Intergenic
943328965 2:186536205-186536227 CAAAGGAAATTGAGAAAGAGTGG + Intergenic
943355083 2:186845039-186845061 CAAAGGGAAAGGATAATGAGGGG + Intronic
944688421 2:202137922-202137944 CAAAGGCAAACGCCAAAGTGGGG - Intronic
944948891 2:204724266-204724288 CAAACTAAAATGCTAAAGAGAGG - Intronic
947161455 2:227219322-227219344 CAAATGGAAAAGGCAAAGATGGG - Intronic
947708738 2:232297159-232297181 CATAGAGAAATGCCTTAGAGGGG - Intronic
948412422 2:237774441-237774463 AAAACGGAAACTCCAAAGAGAGG + Intronic
948739875 2:240038874-240038896 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
1169350212 20:4862747-4862769 TAAAGGAAAAAGCCAGAGAGGGG + Intronic
1169692844 20:8352274-8352296 AAAAAGGCAATGCCATAGAGAGG + Intronic
1169775475 20:9247798-9247820 CAGAGTGCAATGCCCAAGAGTGG - Intronic
1170513201 20:17100639-17100661 TTCAGGGAAATGCCAAAGTGGGG - Intergenic
1170786107 20:19469050-19469072 CAAAGGGCAATGCTTAGGAGGGG + Intronic
1171162616 20:22941719-22941741 CAAAGGGAGGTGCCACAGAGAGG - Intergenic
1171245805 20:23608673-23608695 CCTAGGGAAATGCCAAGCAGGGG - Intergenic
1172785691 20:37466933-37466955 CTAGGGGAAATACCCAAGAGTGG - Intergenic
1173077115 20:39829745-39829767 CAAGGGGAATTAGCAAAGAGAGG + Intergenic
1173557301 20:43974873-43974895 CACAGGGACAGGCCAGAGAGGGG - Intronic
1174717669 20:52777236-52777258 GGAAGGGAAATGCAAAAGAAGGG + Intergenic
1174946510 20:54992176-54992198 AAAAGGGAAATGCCAAAAAACGG - Intergenic
1175020882 20:55848010-55848032 GAAAAGGAAATGCCAAACACAGG + Intergenic
1175134924 20:56815927-56815949 CAAGGGGAAATGCAGAAGCGTGG + Intergenic
1175660425 20:60807979-60808001 CGAAGGGGAATGCAACAGAGAGG - Intergenic
1175663622 20:60839254-60839276 CAAAAGGAAATGCAAGAGAGTGG - Intergenic
1177179387 21:17728345-17728367 CCAAGGGAAAGGGAAAAGAGGGG - Intergenic
1179949925 21:44703760-44703782 CAAAGGAAACCCCCAAAGAGTGG - Intronic
1181496905 22:23292326-23292348 CCCAGGGAAATTCCACAGAGCGG + Intronic
1182504242 22:30770736-30770758 CAGAGGGAAAGGACACAGAGGGG - Intronic
1182737948 22:32544506-32544528 CTATGGGATTTGCCAAAGAGTGG - Intronic
949284066 3:2380781-2380803 CAAAAGGGGATGCCTAAGAGAGG + Intronic
949810576 3:8002486-8002508 CAGAGGGCCATGCCAATGAGAGG + Intergenic
950005935 3:9691046-9691068 CAGAGGGAAAAACCATAGAGGGG - Intronic
950511890 3:13434365-13434387 GAAAGGGAGATGGCAAAGTGTGG - Intergenic
951155373 3:19346532-19346554 CAAAGAGAAATGCCAGACAGGGG + Intronic
951355334 3:21660146-21660168 CAAAGAGAAAGAGCAAAGAGAGG - Intronic
952807815 3:37374325-37374347 CAAAAGGAAGTGACAGAGAGTGG + Intergenic
953040376 3:39250730-39250752 GAAGGGGAAAGGCCACAGAGGGG - Intergenic
954100549 3:48369273-48369295 CAGAGGGAAACACCAAAGAGAGG - Intergenic
955225946 3:57060558-57060580 CAAAGGGATATGCCAGGGAGGGG - Exonic
955580283 3:60412465-60412487 GAGAGGGAAATGCGTAAGAGAGG - Intronic
955830378 3:62995139-62995161 CAAGTGGAAATGCCAAATAAGGG - Intergenic
955935675 3:64100230-64100252 CAAAGTGAAACTCCAAATAGAGG - Intronic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
957396248 3:79642484-79642506 CAAAGGTCAAGGACAAAGAGGGG + Intronic
959348484 3:105230282-105230304 CATAGGTAAATGCCAGAGTGGGG - Intergenic
959616299 3:108351721-108351743 AAAAGGGAATTGGAAAAGAGTGG - Intronic
960816362 3:121677284-121677306 CAAAGTGCAATACCAAAGACAGG - Exonic
961658299 3:128455215-128455237 GAAAGAGAATTGCAAAAGAGAGG + Intergenic
962035024 3:131642722-131642744 CAAAGGGAAGTGCCAAGCAAAGG - Intronic
963811483 3:149781141-149781163 AAAAGGGAAATACCAAACATAGG + Intronic
963819132 3:149868774-149868796 CAAAGGTCAAGGACAAAGAGAGG - Intronic
963960652 3:151305373-151305395 CAAAGGAAAATACCAATGGGTGG - Intronic
964285320 3:155111388-155111410 CAAAGGGAAATTTTAAAGAGTGG + Intronic
964814156 3:160698740-160698762 CAAAGGAAAAAGCCATAGTGTGG - Intergenic
965512853 3:169588292-169588314 CAAAAGGAGTTGCCAAAGAAAGG - Intronic
966467882 3:180252116-180252138 CTAAGGGAAATGACAAATACTGG - Intergenic
966833560 3:184031716-184031738 CCCAGAGAAGTGCCAAAGAGAGG + Intronic
967704398 3:192632988-192633010 CAGAGAAAAATGCCAAAGTGGGG - Intronic
968937486 4:3619731-3619753 CATAAGGAAATGCCACAGACTGG + Intergenic
969317216 4:6389503-6389525 CGAAGGGAAATGTCAGGGAGAGG + Intronic
969473742 4:7408527-7408549 CAAAGGTCAAGGACAAAGAGAGG - Intronic
970190127 4:13508162-13508184 CAAGGACAAATGCCAAAAAGAGG - Intergenic
970203531 4:13633113-13633135 GGAATGGAGATGCCAAAGAGTGG - Intergenic
972081136 4:35151719-35151741 CAAAGGAAAATGCCAGTGAATGG - Intergenic
973087343 4:46082031-46082053 CAAAGGCAAAAGCGAAGGAGAGG + Intronic
973321250 4:48812473-48812495 CAAAGGAAACTGAAAAAGAGTGG + Intronic
975774402 4:77768549-77768571 CAAAAGGAAAAGCCATAGAGTGG + Intronic
976177560 4:82370538-82370560 CAAGGGGAAAAGCAAAAAAGAGG - Intronic
976833826 4:89347206-89347228 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
977550568 4:98438172-98438194 CAAAGAAAAATACCAGAGAGAGG - Intronic
977605918 4:98984853-98984875 AAAAGGGAATTCCCAAAGAGAGG + Intergenic
978889019 4:113800192-113800214 TAAAGTGAAAGGGCAAAGAGAGG - Intergenic
978969000 4:114779579-114779601 CAAAGGTCAATGACAAGGAGAGG - Intergenic
983218408 4:165021928-165021950 AGAAGGGAAAAGACAAAGAGTGG - Intergenic
986154186 5:5157322-5157344 CAAATGGAAATACCAAATAAGGG + Intronic
986192953 5:5513684-5513706 AAAAGGGAAATGCAAAGGAATGG - Intergenic
987160300 5:15134609-15134631 GAAAGAGAAAAGCCAATGAGAGG - Intergenic
987182168 5:15379552-15379574 GAAAAGGAAAAGCCAAAGACTGG + Intergenic
987261882 5:16212650-16212672 AAAAGTGAAATGTCAAAGAAGGG - Intergenic
987281645 5:16419836-16419858 CAAAGGGAAAGATAAAAGAGGGG + Intergenic
987544923 5:19302611-19302633 CAAAGGGAGAGGCTAAAGAGAGG - Intergenic
988455185 5:31381328-31381350 AAAAGGGAAATGGGACAGAGAGG + Intergenic
989448910 5:41563998-41564020 CAAGGAGAAATACTAAAGAGAGG - Intergenic
990257328 5:53984387-53984409 CAAAGGAAAAAGCAAAAGAAAGG - Intronic
990565924 5:57028801-57028823 GAAAGGAAAGTGCCAGAGAGGGG + Intergenic
990637746 5:57748436-57748458 CAAAAGGGAATGAGAAAGAGGGG + Intergenic
991567984 5:68024728-68024750 CCAAGGGAAATGCAACAGTGTGG - Intergenic
992654887 5:78899239-78899261 CAAAGGTCAAGGACAAAGAGAGG - Intronic
995216189 5:109597550-109597572 CATAGGGATATGCCAATGAGGGG - Intergenic
996600946 5:125263413-125263435 CAAAGGTAAGTGGCAGAGAGAGG + Intergenic
999096418 5:148981844-148981866 CAGAGGGAAATCCTAAAGTGAGG - Intronic
999933481 5:156459146-156459168 CAAAGGGAGAAGACAAAGACAGG - Intronic
999949186 5:156630202-156630224 CAAATACAAATGCCAAAGACTGG + Intronic
1000462745 5:161543550-161543572 AAAAGCAAAATGCAAAAGAGAGG + Intronic
1000598690 5:163246263-163246285 CATAAGAAAATGCCAAAGACTGG - Intergenic
1000821839 5:165994252-165994274 GAAAGGGACATTCCAAACAGTGG - Intergenic
1001157714 5:169287541-169287563 CAAAGGGAAATGCATTAGAAAGG - Intronic
1001305098 5:170566693-170566715 CAAAAAGAAAAGCCAAGGAGGGG + Intronic
1001557150 5:172644469-172644491 AATAAGGAAATGCCAAAGAAAGG + Intronic
1001632788 5:173188663-173188685 CAAAGGTAAAATACAAAGAGGGG - Intergenic
1002870559 6:1163660-1163682 CAAAAGGAAAAGCAAATGAGAGG + Intergenic
1005155202 6:22796979-22797001 AAAAGAGAAATTCCAAAGAAGGG - Intergenic
1005177786 6:23067531-23067553 AAAAGGGAATTGCACAAGAGAGG + Intergenic
1006713655 6:36098785-36098807 CCAAGGGAAATAACAAAAAGGGG - Intronic
1009809232 6:68639428-68639450 AGAAGGTAAGTGCCAAAGAGAGG + Exonic
1010397043 6:75404585-75404607 CAGAGGGGAATGCTAAAGAAAGG - Intronic
1011676481 6:89739332-89739354 CAAGTAGAAATGCCACAGAGAGG - Intronic
1012826610 6:104153910-104153932 GAAAGGGAAAGGGCTAAGAGAGG - Intergenic
1014198104 6:118581469-118581491 CAAAGGGAAATAACAAGCAGAGG + Intronic
1014518554 6:122409283-122409305 CCAAATGAAATGCCACAGAGAGG + Intronic
1014610328 6:123535671-123535693 CAAAGTACAATGCCAAACAGAGG + Intronic
1015436027 6:133189537-133189559 CAAAATGAAATCCAAAAGAGTGG + Intergenic
1018390567 6:163338009-163338031 CTCAGGGAGATGCCCAAGAGGGG - Intergenic
1018555853 6:165050072-165050094 CAAAGGGAAATCACAGACAGAGG + Intergenic
1019107777 6:169683269-169683291 CAAAGGTCAAAGACAAAGAGAGG + Intronic
1019383426 7:740181-740203 CAAAGGGCAATGCCTGAGACGGG - Intronic
1023029926 7:36082721-36082743 CAACAGGAAATGGAAAAGAGTGG + Intronic
1024689267 7:51781450-51781472 CAAAGGGAGATTCCAGAGAAGGG + Intergenic
1026762003 7:73133889-73133911 CAATGGGAAGTGCCCAACAGAGG - Intergenic
1026956924 7:74382719-74382741 AAAAGGCAAATGACAAAGTGGGG - Intronic
1027038344 7:74942713-74942735 CAATGGGAAGTGCCCAACAGAGG - Intergenic
1027085219 7:75258769-75258791 CAATGGGAAGTGCCCAACAGAGG + Intergenic
1027885943 7:83904902-83904924 CAAAGAGAATTACCAAAAAGAGG - Intergenic
1028560581 7:92170449-92170471 CAAAGGTCAAAGACAAAGAGAGG + Intronic
1029027796 7:97435881-97435903 CAAAGGGAATAGCCTATGAGAGG + Intergenic
1029060662 7:97794949-97794971 CTAGGGTAAATGCCTAAGAGTGG - Intergenic
1029151609 7:98484307-98484329 AGAATGGAAATGCCCAAGAGAGG - Intergenic
1029796972 7:102906772-102906794 CAAAGGTCAAGGACAAAGAGAGG - Intronic
1030298122 7:107948912-107948934 AAAAAGGAAATGCCAAAGGGAGG + Intronic
1030671018 7:112337159-112337181 AAAAGGGAAATGCCAAGGAGCGG + Intronic
1031234727 7:119160129-119160151 CAAACAGAAAACCCAAAGAGTGG - Intergenic
1031348582 7:120700082-120700104 CAGTGGGAAATGCCATAGATTGG + Intronic
1031382325 7:121102440-121102462 CAAAGGGAAGTGACCAAAAGTGG - Intronic
1032921903 7:136558487-136558509 GAAATGGAAATACCAAAGAAAGG + Intergenic
1033132602 7:138757880-138757902 CGTAAGGAAATGCCAAAGACAGG - Intronic
1033635016 7:143204290-143204312 CAAAGAGAAATGCCCAGGATGGG + Intergenic
1033819176 7:145112814-145112836 CAAAGCAGAATGGCAAAGAGAGG - Intergenic
1034456114 7:151171490-151171512 CAGATGGAGATGTCAAAGAGGGG - Intronic
1038218784 8:25587865-25587887 CAAAGCAAAAAGGCAAAGAGTGG - Intergenic
1039364630 8:36916984-36917006 AAAAGGGGAAATCCAAAGAGAGG - Intronic
1040650690 8:49446020-49446042 AAAAGGCAAATGCAAAAGGGTGG - Intergenic
1041732057 8:61072257-61072279 CAAAGAAAAATGCCACAGAGCGG - Intronic
1043163008 8:76869978-76870000 AAAAAGGAAAGGCCAAAGAGAGG - Intergenic
1043403075 8:79902756-79902778 CAATGGGTCATGCCACAGAGGGG - Intergenic
1043663889 8:82783851-82783873 TAAATGAACATGCCAAAGAGTGG - Intergenic
1043774177 8:84243894-84243916 CAAAGGGAAATGCCAAAGAGAGG - Intronic
1044735043 8:95270110-95270132 CAAAGAGAAAGGCGAAGGAGTGG - Intergenic
1045589512 8:103578185-103578207 CAAAGGTCAAGGACAAAGAGAGG + Intronic
1045606229 8:103780171-103780193 CAAAGGTAAAGGATAAAGAGAGG - Intronic
1049183262 8:141234465-141234487 GAAAGGGAAATGTCAAAATGGGG - Intronic
1051032315 9:12695964-12695986 GAAAACGAAATGCCAAAGACAGG - Intronic
1051204532 9:14670896-14670918 GAAAGGGAAATGACTAAGAAAGG - Intronic
1051311958 9:15785000-15785022 AAAAGGAAAATTCTAAAGAGAGG - Intronic
1051465610 9:17374168-17374190 CAAAGAGACAAGCCACAGAGTGG + Intronic
1051572715 9:18578543-18578565 CAAAGGCACATGCCAATGAGTGG - Intronic
1052224257 9:26065607-26065629 CAAAGAGAAATGCAAATGTGTGG - Intergenic
1052977177 9:34419904-34419926 CGACAGGAAATGCCACAGAGAGG - Intronic
1053603797 9:39636692-39636714 CAAAGGGGAGTGACAAAGAGCGG + Intergenic
1053861671 9:42393048-42393070 CAAAGGGGAGTGACAAAGAGCGG + Intergenic
1054249743 9:62705727-62705749 CAAAGGGGAGTGACAAAGAGCGG - Intergenic
1054453670 9:65417962-65417984 CATAAGGAAATGCCACAGACTGG - Intergenic
1054563854 9:66740259-66740281 CAAAGGGGAGTGACAAAGAGCGG - Intergenic
1054734954 9:68741748-68741770 TGAAGAGAAATGCCAAAGAGAGG - Intronic
1055008202 9:71533822-71533844 CAAAGGGCAATTACAAACAGTGG - Intergenic
1055407990 9:75994823-75994845 CAAAGGGAAATGACTAAATGGGG - Intronic
1055530088 9:77175599-77175621 CAAATGGAAAAACAAAAGAGGGG - Intergenic
1056278668 9:85018465-85018487 CACATGGCAATGCCAAGGAGAGG - Intronic
1056588090 9:87941445-87941467 CAAAGGAGGATGCCAAAGAAAGG + Intergenic
1056608776 9:88111500-88111522 CAAAGGAGGATGCCAAAGAAAGG - Intergenic
1056958442 9:91101328-91101350 CAAAGGGAAATGCTGCTGAGAGG + Intergenic
1057259034 9:93574085-93574107 CATAGGGAGAAGCCAAACAGAGG + Intergenic
1057296216 9:93844260-93844282 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
1057556732 9:96094211-96094233 CTAAGGGAAATGTCAAGGCGAGG + Intergenic
1057581487 9:96291150-96291172 CAAAGGAAGAGGACAAAGAGGGG - Intronic
1058069002 9:100582681-100582703 CAGGGGGAACTCCCAAAGAGAGG - Intronic
1059132763 9:111771840-111771862 CAAAGGTCAAGGACAAAGAGAGG - Intronic
1059779433 9:117510605-117510627 CAAAGGCAAATGCCAAAAGGTGG - Intergenic
1061791168 9:133059936-133059958 CAACAGGAAATGCCAGGGAGGGG - Intergenic
1061886549 9:133593865-133593887 GGAAGGGAAATTCCAAGGAGAGG - Intergenic
1186994642 X:15106747-15106769 CAAAGGTCAATGACAAAGAGAGG - Intergenic
1188688804 X:33103552-33103574 TAAAGGAAAATTACAAAGAGGGG - Intronic
1189625978 X:42897128-42897150 CAAAGGGAAATACAAGAGACTGG - Intergenic
1189733605 X:44047406-44047428 CAAAGTGAAATGGCAGAGAAAGG - Intergenic
1190498328 X:51049362-51049384 CAAAGGTCAAGGACAAAGAGAGG + Intergenic
1190508065 X:51148229-51148251 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
1190880911 X:54492105-54492127 CCCAGTGAAATGCCAGAGAGGGG - Intronic
1192057492 X:67787200-67787222 CAAGGGGAACTATCAAAGAGAGG + Intergenic
1192221014 X:69197371-69197393 GAAAGGAGAATGCCAAAGATTGG + Intergenic
1192970595 X:76224783-76224805 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
1193335719 X:80286324-80286346 CAAAGGTCAAGGACAAAGAGAGG + Intergenic
1194229853 X:91308027-91308049 TAAAGGTACATGACAAAGAGAGG - Intergenic
1195036903 X:100978519-100978541 CAAATGGAAACCCAAAAGAGCGG - Intronic
1195073482 X:101303785-101303807 CAAAGGTAAAGGACAAAGAGAGG - Intergenic
1195560363 X:106276317-106276339 CAAAGGGTATTGCCAGAGATGGG - Intergenic
1195561599 X:106290022-106290044 CAAAGGGTATTGCCAGAGATGGG + Intergenic
1196824833 X:119732832-119732854 GAAAGGGAAAAGACACAGAGAGG + Intergenic
1196987037 X:121285427-121285449 CAAAGGTCAAGGACAAAGAGAGG - Intergenic
1197137998 X:123085132-123085154 CAAAGAGAAGTGACACAGAGGGG + Intergenic
1197594960 X:128453586-128453608 CAAATGGAAATGCTGAAGAAAGG + Intergenic
1197604765 X:128572611-128572633 CAAAAGGAACTACCAAAGAAAGG + Intergenic
1197936933 X:131749244-131749266 CAAAAGCAAATGGCTAAGAGTGG - Intergenic
1197937600 X:131755536-131755558 CAAAAGCAAATGGCTAAGAGTGG - Intergenic
1197996808 X:132385863-132385885 CAATGGTAAATGCCCAAGATTGG - Intronic
1198430612 X:136563126-136563148 CAAAGGTAAAGGATAAAGAGAGG - Intergenic
1199694457 X:150334183-150334205 CAATGAGAAATCCCAAAGTGTGG + Intergenic
1200295670 X:154917371-154917393 CAAAGGTCAAAGACAAAGAGGGG - Intronic
1201102900 Y:10691932-10691954 CAGAGTGGAATGGCAAAGAGAGG - Intergenic
1201339840 Y:12922810-12922832 CTGAGGGAAATTCCATAGAGGGG - Intergenic