ID: 1043774335

View in Genome Browser
Species Human (GRCh38)
Location 8:84246015-84246037
Sequence ATTCAGAAGCCAAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043774331_1043774335 6 Left 1043774331 8:84245986-84246008 CCCTGAATAATGTAATATCATGT 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1043774335 8:84246015-84246037 ATTCAGAAGCCAAAGGAAGATGG No data
1043774332_1043774335 5 Left 1043774332 8:84245987-84246009 CCTGAATAATGTAATATCATGTG 0: 1
1: 0
2: 0
3: 7
4: 168
Right 1043774335 8:84246015-84246037 ATTCAGAAGCCAAAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043774335 Original CRISPR ATTCAGAAGCCAAAGGAAGA TGG Intronic
No off target data available for this crispr