ID: 1043774896

View in Genome Browser
Species Human (GRCh38)
Location 8:84254322-84254344
Sequence CAGAATTGCTTCAGTTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043774896_1043774901 27 Left 1043774896 8:84254322-84254344 CCACTCTAACTGAAGCAATTCTG 0: 1
1: 0
2: 3
3: 19
4: 289
Right 1043774901 8:84254372-84254394 TGTAGTCAGAGAAGTACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043774896 Original CRISPR CAGAATTGCTTCAGTTAGAG TGG (reversed) Intronic
900652221 1:3735271-3735293 CAGATGTGCTTCAGTTCCAGAGG + Exonic
901359095 1:8680374-8680396 CAGAAGTGCTTTGGTTAGAAAGG - Intronic
902386867 1:16081046-16081068 CAGAATTGCTTGAATGAGGGAGG - Intergenic
902530444 1:17087329-17087351 CACAATTGTTTCAGGCAGAGGGG - Intronic
904182214 1:28674058-28674080 CAGAATTGCTTGAACTAGGGAGG + Intronic
904973522 1:34437590-34437612 CTGAATTCTTTCAGTTACAGAGG + Intergenic
905385495 1:37600698-37600720 AAGAATTGCTTGAGCTTGAGAGG + Intergenic
905852985 1:41287804-41287826 GAGAATTGCTTGAGCTGGAGAGG + Intergenic
906174145 1:43754858-43754880 AAGAATTGCTTGAGTTTGTGAGG + Intronic
906311629 1:44758521-44758543 CAGAGTTGCTTTCCTTAGAGTGG + Intronic
907696267 1:56732510-56732532 CAGAATTGCTTCAGCTACTTGGG - Intronic
908886730 1:68797817-68797839 CAGAATTGCTTGAACTCGAGAGG - Intergenic
909400781 1:75227273-75227295 TAGAATTGCTTGAGTTTGGGAGG + Intronic
911132126 1:94399763-94399785 CCGCAGTGCTGCAGTTAGAGGGG + Intergenic
911236567 1:95418408-95418430 GAGAATTGCTTGAGTTGGGGAGG + Intergenic
911470841 1:98316338-98316360 CAGATTTGCCTCTTTTAGAGAGG - Intergenic
912595909 1:110875525-110875547 CTGCATTGATTCAGTTATAGTGG + Intronic
915688469 1:157661923-157661945 CAGAATTGCTTCAGCTAATTAGG + Intergenic
915787491 1:158631330-158631352 CTGAGTTACTTCACTTAGAGTGG - Intronic
917748194 1:178031071-178031093 CAGAATTGCTTCAGAGAGGTGGG - Intergenic
917819913 1:178752223-178752245 GAGAATTGCTTCAGCTTGGGAGG - Intronic
918735814 1:188061853-188061875 CAGAATTTCTTTAGTTAATGAGG + Intergenic
918760285 1:188395878-188395900 AAGAATTGCTTGAGTTAGGGAGG + Intergenic
919161413 1:193835491-193835513 GAGAATTGCTTCAATTTGGGAGG + Intergenic
919501700 1:198345465-198345487 AAGAATTCCTTCACTTAGAGAGG + Intergenic
923644737 1:235807031-235807053 CTGAATTGCTTCATTTAATGTGG - Intronic
1064252282 10:13715814-13715836 CAGAATTGCTTGAATTCGGGAGG + Intronic
1064389592 10:14930199-14930221 GAGAATTGCTTGAGTTTGGGAGG - Intronic
1065659894 10:27995050-27995072 CAATATCGCTTCATTTAGAGGGG + Exonic
1066107889 10:32171708-32171730 GAGAATTGCTTCAATTTGGGAGG - Intergenic
1066118731 10:32263228-32263250 GAGAATTGCTTCAGTCTGGGAGG + Intergenic
1067356023 10:45527741-45527763 GATACTGGCTTCAGTTAGAGAGG - Intronic
1068580746 10:58736675-58736697 CAGACTTTCTTCAATAAGAGTGG - Intronic
1070701862 10:78609121-78609143 CAGAATAGCACCAGTTAGAGTGG + Intergenic
1071995214 10:91141162-91141184 CAGAATTGCTTCATGTGTAGGGG + Intergenic
1072659264 10:97353171-97353193 GAGAATTGCTTGAATTTGAGAGG - Intergenic
1073412942 10:103357451-103357473 GAGGATTGCTTGAGTCAGAGAGG + Intergenic
1073800612 10:107037711-107037733 CCCAATTGCTTCAGCTAGAGAGG + Intronic
1076036856 10:127206231-127206253 CAGAATTGCTTGAGTTTGGGAGG - Intronic
1079308960 11:19347539-19347561 CAGAAGATCTTCAGTAAGAGTGG + Intergenic
1079837262 11:25350433-25350455 CAGAATTGCTGCAGTGACAGTGG + Intergenic
1079991024 11:27247157-27247179 CATTATTACTTCAGTAAGAGAGG - Intergenic
1082026216 11:47574405-47574427 AAGAATTGCTTGAATTTGAGAGG + Intronic
1082596738 11:55090898-55090920 AAGAATTGTTTAAGTTAGCGAGG + Intergenic
1082843700 11:57710670-57710692 CAGAACTACTTTAGCTAGAGTGG - Intronic
1082994123 11:59235325-59235347 CAGAAAGGCTTCACTTAGAAAGG + Intergenic
1083350040 11:62021353-62021375 CAGAAATCCTTTAGTTAGGGGGG - Intergenic
1084205273 11:67587779-67587801 GAGAATTGCTTGAGTCTGAGAGG - Intergenic
1084305664 11:68281589-68281611 GAGAATTGCTTCAATCAGGGAGG - Intergenic
1086358820 11:86035856-86035878 CAGAATTGCTTGAGTCTGGGAGG + Intronic
1087056060 11:93937566-93937588 GAGAATTGCTTGAGATCGAGAGG + Intergenic
1087865170 11:103216700-103216722 GAGGATTGCTTGAGTTTGAGAGG + Intronic
1088404070 11:109452391-109452413 CAGGATTGCTTGAGTCAGGGGGG + Intergenic
1091026397 11:132145432-132145454 CAGACTTGCTGTAGTAAGAGAGG + Intronic
1093074356 12:14742114-14742136 GAGAATTGCTTGAGCCAGAGAGG + Intergenic
1093387698 12:18579429-18579451 CAGAATTGGTTAAGTTAGATGGG + Intronic
1093409303 12:18845441-18845463 CAGACTTGGTGCTGTTAGAGGGG - Intergenic
1093614081 12:21199889-21199911 GAGAATTGCTTGAATTAGGGAGG - Intronic
1093693154 12:22130042-22130064 CAGAATTGCTTGAGCTCGGGAGG + Intronic
1094139130 12:27162682-27162704 GAGGATTGCTTCAGCTAGGGAGG - Intergenic
1095984437 12:47990094-47990116 CAGAATTGCTTGAACTTGAGAGG - Intronic
1096270679 12:50164047-50164069 GAGAATTGCTTGAGTTGGAGAGG - Intronic
1097259298 12:57706757-57706779 GAGGATTGCTTTAGTTGGAGAGG + Intronic
1097498064 12:60367860-60367882 CAGAATTGCTTTAGCTATTGAGG - Intergenic
1097539751 12:60925587-60925609 CAGAATTGACTCACATAGAGTGG + Intergenic
1097646710 12:62243868-62243890 CAGGATTGCTTGAGCTGGAGAGG - Intronic
1098569338 12:71971160-71971182 CAGGGTTGCTGCAGTGAGAGGGG - Intronic
1101064655 12:101007258-101007280 CAGAATTGCTTAAATCCGAGAGG + Intronic
1101295573 12:103420259-103420281 CACAAAGGGTTCAGTTAGAGGGG - Intronic
1101361295 12:104030021-104030043 CAAAATTGCTTCAGTTATTTGGG - Intronic
1104849638 12:131865885-131865907 GAGAATTGCTTCAGCCAGGGAGG + Intergenic
1105386302 13:19932554-19932576 CAGAATTGCTTCAGCCTGGGAGG + Intergenic
1105902753 13:24771239-24771261 GAGGATTGCTTCAGCTGGAGAGG - Intronic
1108021461 13:46132105-46132127 CAGAATTGATTAAGTAAAAGAGG - Intronic
1108949034 13:56063809-56063831 GAGAATTGCTTGAGTCAGGGAGG + Intergenic
1109191185 13:59326056-59326078 CAGGACTTCTTCAGTTATAGGGG + Intergenic
1109516743 13:63452897-63452919 CAGAATTGCTTTAGTTATTCAGG - Intergenic
1110647080 13:77900134-77900156 TAGAAATGCTAGAGTTAGAGGGG - Intronic
1110812591 13:79827042-79827064 CAGAATTTCTTCCTTTTGAGTGG - Intergenic
1111876100 13:93898102-93898124 CATAATTGCTTCAATTGTAGAGG - Intronic
1112801973 13:103122223-103122245 GAGAATTGCTTCAGTCTGGGAGG + Intergenic
1114056385 14:18971235-18971257 CAGAAATGCTTCTGTTTGAAAGG - Intronic
1114106165 14:19430492-19430514 CAGAAATGCTTCTGTTTGAAAGG + Intronic
1114465096 14:22916344-22916366 GAGGATTGCTTGAGCTAGAGAGG - Intronic
1117175446 14:53141427-53141449 CAGAATTTCTTCTATTAAAGAGG + Intronic
1117211218 14:53502360-53502382 ATGAAGTGCTTCAGTTACAGGGG - Intergenic
1118490134 14:66250745-66250767 GAGAATTGCTTGAATTAGGGAGG + Intergenic
1119232317 14:72990484-72990506 GAGAATTGCTTGAATTTGAGAGG - Intronic
1121357363 14:93227018-93227040 CAGTATTACTGCAGCTAGAGTGG + Exonic
1122225280 14:100273049-100273071 GAGAATTGCTTCAGCCAGAGAGG - Intronic
1123985647 15:25643660-25643682 GAGAATTGCTTCAGCCAGGGAGG + Intergenic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1125870048 15:43091994-43092016 GAGAATTGCTTGAGTCAGAGAGG + Intronic
1125887005 15:43236655-43236677 GACATTTGCTTCAGTAAGAGTGG + Intronic
1126008655 15:44282307-44282329 CAGAATTGCCTCAGCTAAAGAGG - Intergenic
1126131392 15:45344969-45344991 GAGAATTGCTTGAATTAGGGTGG + Intergenic
1126749680 15:51864174-51864196 GAGAATTGCTTGAGCCAGAGAGG + Intronic
1127468712 15:59270726-59270748 GAGAATTGCTTAAGTTTGGGAGG - Intronic
1128655868 15:69461700-69461722 GAGAATTGCTTCAGCCAGGGAGG + Intergenic
1133922827 16:10169352-10169374 CAAAATTGCTTCTGTTAGCAAGG - Intronic
1134066103 16:11229442-11229464 GAGGATTGCTTGAGTTGGAGAGG - Intergenic
1134079986 16:11318489-11318511 GAGAATTGCTTGAGTCAGGGAGG - Intronic
1134166337 16:11932866-11932888 CAGAATTGCTTCAAATTGGGAGG + Intronic
1135519704 16:23166018-23166040 GAGGATTGCTTGAGCTAGAGAGG - Intergenic
1136014608 16:27387642-27387664 GAGAATGGCTTGAGTTTGAGAGG + Intergenic
1137395704 16:48115051-48115073 CAGAATTGCTGGAGTAAGGGTGG + Intronic
1137417639 16:48298978-48299000 GAGAATTGCTTCAGCTGGGGAGG - Intronic
1137646994 16:50084193-50084215 GAGAATTCCTTCAGTGAGTGCGG + Exonic
1138795330 16:59961147-59961169 TAGAATGGCCTTAGTTAGAGGGG - Intergenic
1141712521 16:85708241-85708263 CGGAACTGCTTCAGTTTAAGAGG + Intronic
1142758870 17:2031470-2031492 GAGAATTGCTTGAGTCCGAGAGG + Intronic
1143123912 17:4628980-4629002 CAGAATTGCTTGAACTCGAGAGG - Intergenic
1143329784 17:6125060-6125082 CTGAATTGCTGCTGTTGGAGGGG + Intergenic
1145036753 17:19546268-19546290 GAGAATGGCTTCAGTATGAGTGG + Intronic
1146026547 17:29326501-29326523 GAGAATTGCTTCAATTCAAGAGG + Intergenic
1148067878 17:44886142-44886164 CAGAATTGCTTGAATCAGGGAGG + Intronic
1150317779 17:64184186-64184208 CAGAATTGCTCGAGTCAGGGAGG - Intronic
1150917897 17:69455157-69455179 GAGAGTTGCTTCATTTAGTGAGG + Intronic
1151075982 17:71273098-71273120 CGCCATTGCTTCAGTTATAGGGG - Intergenic
1152766339 17:82141980-82142002 CAGAACTGGTTCTGGTAGAGGGG - Intronic
1155708560 18:28847256-28847278 CAGAACTACTGCAGTTACAGTGG - Intergenic
1155739545 18:29271015-29271037 GAGAATTGCTTCAGCTAGGGAGG - Intergenic
1156926601 18:42588197-42588219 AAAAATTGCTTCAGTGAAAGAGG - Intergenic
1156962015 18:43043698-43043720 GAGAATTGCTTCAATCAGGGAGG + Intronic
1157252896 18:46111412-46111434 CAGAATTGCTTGAGCTGGGGAGG - Intronic
1158252641 18:55506950-55506972 GAGAATTGCTTGAGTCTGAGAGG - Intronic
1158716363 18:59883293-59883315 CAGAGTTGCTTCATTTACTGGGG - Intergenic
1158936947 18:62373367-62373389 GAGAATTGCTTGAGTCAGGGAGG + Intronic
1159539205 18:69754262-69754284 CAGAATTGCTTGAGCTTGGGAGG + Intronic
1159941167 18:74410013-74410035 GAGAATTGCTTGAACTAGAGAGG + Intergenic
1162603498 19:11688841-11688863 CAGAATTGCTTGAGCTCCAGAGG + Intergenic
1163363688 19:16864202-16864224 TAGAATTGCTTGAGCCAGAGAGG + Intronic
1164484614 19:28644257-28644279 CAGTAGTGCTTCAGTTGTAGTGG - Intergenic
1165023351 19:32941411-32941433 GAGAATTGCTTGAGTTTGGGAGG + Intronic
1165707212 19:37985284-37985306 GAGGATTGCTTGAGCTAGAGAGG - Intronic
1165713284 19:38027196-38027218 CAGAATTGCTTGAGTCTGGGAGG + Intronic
1166278847 19:41776249-41776271 AAGAATTGCTTTAGTTGAAGAGG - Intergenic
925175894 2:1783379-1783401 GAGAATTGCTTGAGCTAGGGAGG - Intergenic
925968801 2:9092372-9092394 CAGAATTGTTAGAGTTAAAGAGG - Intergenic
926038663 2:9655230-9655252 GAGAATTGCTTGAGCCAGAGAGG + Intergenic
928954236 2:36845399-36845421 AAGATTTGCTTCAGTTAAAATGG + Exonic
929865194 2:45711715-45711737 CAGAATTGCTTGAACCAGAGAGG - Intronic
931006277 2:57853284-57853306 CAGCTTTGTTTCTGTTAGAGTGG - Intergenic
931276835 2:60751582-60751604 GAGAATTGCTTGAGCTCGAGAGG - Intergenic
932780860 2:74557407-74557429 CAGAATGGGTGCAGTTTGAGGGG + Exonic
934779199 2:96958598-96958620 GAGAATTGCTTCAGTCAGAGGGG + Intronic
935357228 2:102213150-102213172 CACAATTGTTTCAGTTGTAGGGG + Intronic
937548763 2:123060053-123060075 GAGAATTGCTTGAACTAGAGAGG - Intergenic
937732024 2:125244496-125244518 CAGAATTGCTTTAAAAAGAGAGG - Intergenic
937751690 2:125482893-125482915 CTGAATTACTTCACTTAGAATGG + Intergenic
938067715 2:128291099-128291121 CAGAATTGCCTTAGAGAGAGTGG - Intronic
938285921 2:130116828-130116850 CAGAAATGCTTCTGTTTGAAAGG + Intronic
938429684 2:131222074-131222096 CAGAAATGCTTCTGTTTGAAAGG - Intronic
938474505 2:131595260-131595282 CAGAAATGCTTCTGTTTGAAAGG - Intergenic
939338322 2:140860163-140860185 ATGAATTGCTTCACATAGAGAGG - Intronic
940390714 2:153129678-153129700 CAGAATTGCTTGAACTAGGGAGG + Intergenic
940582852 2:155602799-155602821 GAGAATTGCTTCAGCTTGGGAGG - Intergenic
941615300 2:167711876-167711898 CAGGATTGCTTCAGCTGGGGAGG + Intergenic
941762109 2:169255192-169255214 CATGATTACTCCAGTTAGAGGGG - Intronic
944252150 2:197589130-197589152 CAGAATTGCTTGAACTGGAGAGG + Intronic
944465269 2:199994273-199994295 CAGAAGTCCTTGAGTTTGAGGGG + Intronic
944742742 2:202628303-202628325 GAGAATTGCTTGAACTAGAGAGG - Intergenic
947062148 2:226179247-226179269 CATAGTGGCTTCAGGTAGAGGGG + Intergenic
1169348204 20:4846417-4846439 GAGAATTGCTTGAGTCAGGGAGG + Intergenic
1169737874 20:8856525-8856547 GAGAATTGCTTCAGCCAGGGAGG + Intronic
1170059702 20:12246179-12246201 CAGGAGTGCTTCAGGCAGAGGGG - Intergenic
1170247267 20:14235739-14235761 CAGATGTGCTTCAGTTTGAAAGG - Intronic
1171316384 20:24199378-24199400 CAGGATTGGTTCAGTTACAAAGG + Intergenic
1173575621 20:44111543-44111565 CTGAAGGGCTTCAGTTTGAGTGG - Intergenic
1174091846 20:48055395-48055417 CAGACTTGTTTCAGTAAGAAGGG - Intergenic
1175255089 20:57638606-57638628 GAGAATTGCTTGAGCCAGAGAGG - Intergenic
1176290074 21:5039033-5039055 CAGAATTGCTTGAGTCCGGGAGG - Intronic
1177710778 21:24771955-24771977 GAGAATTGCTTCAATCTGAGAGG - Intergenic
1179010954 21:37555802-37555824 CTGAATTCCTTCAGCTTGAGTGG + Intergenic
1179867181 21:44224606-44224628 CAGAATTGCTTGAGTTCGGGAGG + Intronic
1180474871 22:15693846-15693868 CAGAAATGCTTCTGTTTGAAAGG - Intronic
1183033886 22:35126280-35126302 CAGAATTGCTTGAGCCTGAGAGG - Intergenic
1184492504 22:44818022-44818044 GAGGATTGCTTGAGTTCGAGAGG + Intronic
950887146 3:16372397-16372419 GAGAATGGCTGCAGGTAGAGAGG + Intronic
952728464 3:36614568-36614590 CAAAAGTGCTTCAAGTAGAGAGG + Intergenic
953728856 3:45427909-45427931 GAGAATTGCTTCAATGAGGGAGG - Intronic
954039609 3:47874979-47875001 CAGAATTGCTCCAGGAGGAGAGG - Intronic
954480228 3:50792961-50792983 TAGAATTGTTTCAGTAAGAATGG + Intronic
954957520 3:54534835-54534857 GAGAATTGCTTGAGCTAGGGAGG + Intronic
956726414 3:72160255-72160277 CAGAAGTGCTTCCCTCAGAGGGG - Intergenic
957083971 3:75663451-75663473 CAAAATTGCCTCAGTGAGACGGG - Intergenic
958129643 3:89401695-89401717 AAGAATTGCTTGAGTCAGGGAGG - Intronic
959276960 3:104287668-104287690 GAGAATTGCTTCAATTGGGGAGG + Intergenic
959705974 3:109339099-109339121 GAGAATTGCTTGAGCTGGAGAGG + Intergenic
960386900 3:117031359-117031381 CATAATGGCTAAAGTTAGAGGGG + Intronic
961312527 3:126012647-126012669 CAGAATTTCTTCATCTGGAGGGG + Exonic
964342234 3:155719883-155719905 GAGAATTGCTTGAGCTCGAGAGG - Intronic
964854903 3:161136316-161136338 AAGAAATGCTTGAGTTAGATTGG + Intronic
964882005 3:161433062-161433084 CTGAGTTGCTTCAGTAAGGGAGG + Intergenic
965237961 3:166151861-166151883 CAGAATTGCTCGAGTTCGAGAGG + Intergenic
966233141 3:177671141-177671163 AAGAATTGCTTCAGTTTTTGTGG + Intergenic
966514752 3:180806426-180806448 CATAATTGATTGAGTTAGGGTGG - Intronic
967205121 3:187112645-187112667 GAGAATTGCTTGAGGTAGGGAGG - Intergenic
967284541 3:187855596-187855618 CAGAATTGTTTCAAGTAGACAGG - Intergenic
967445129 3:189556642-189556664 GAGAATTGCTTGAGCTTGAGAGG + Intergenic
967541774 3:190676660-190676682 CAGAATTGATGTAGTGAGAGAGG + Intergenic
969105209 4:4802216-4802238 CAGAATTGCTTGAACTTGAGAGG + Intergenic
971754876 4:30694447-30694469 AAGAATTGCTTGAGTGGGAGGGG + Intergenic
971763245 4:30797048-30797070 GAGAATTGCTTGAGTCCGAGAGG - Intronic
972245448 4:37242504-37242526 CAGCTTTGCCTCAGCTAGAGAGG - Intergenic
973189489 4:47370886-47370908 CTGAATTGCTTCACACAGAGTGG - Intronic
974384124 4:61183088-61183110 AAGAAGTGCTTCAGTTCCAGAGG + Intergenic
974757508 4:66229988-66230010 CAGAATTTCTTCAACTAGGGAGG + Intergenic
976262514 4:83159077-83159099 GAGAATTGCTTAAGTTTGGGAGG + Intergenic
976412420 4:84730888-84730910 CAGAATTGCTTGAACCAGAGAGG - Intronic
977595175 4:98871484-98871506 GTAAATTGCTTCACTTAGAGTGG + Intergenic
977659999 4:99573972-99573994 AAGGATTGCTTCAGTTAGTATGG + Intronic
979867988 4:125779533-125779555 CAGAATTTCATCAGGTACAGTGG - Intergenic
983381444 4:166999764-166999786 CAGCACTGCTTCTGTTAGACGGG - Intronic
983825997 4:172261157-172261179 TAGAATAGCTTCAGTAAGATTGG + Intronic
983902067 4:173146397-173146419 GAGAATTGCTTGAATTAGGGAGG - Intergenic
984921795 4:184771032-184771054 CAGAATTGCTTGAATCAGGGAGG + Intronic
986605023 5:9514188-9514210 AAGATTTGCTGCAGATAGAGAGG - Intronic
989741135 5:44773728-44773750 CAGAATTGGTTCAGAAACAGAGG + Intergenic
990526857 5:56636651-56636673 CAGAATTGCTACAATTTGGGAGG + Intergenic
991672232 5:69059800-69059822 CAGAATAGCTTGAGTAAGATTGG + Intergenic
992164567 5:74036625-74036647 CTAAATTCCATCAGTTAGAGAGG - Intergenic
993648088 5:90483707-90483729 GAGAATTGCTTAAGTGAGGGAGG + Intronic
993726618 5:91375165-91375187 CTGAATTGATTCACCTAGAGAGG + Exonic
994852749 5:105076759-105076781 CAGAATTGCTTAAGCAAGAGAGG + Intergenic
995731317 5:115245168-115245190 CAGAATTGTTTAAGTTGGTGGGG - Intronic
995940070 5:117570987-117571009 CAGAGTTGATTCAGCTACAGAGG + Intergenic
997365481 5:133322619-133322641 CAGAATTGCTTCACTGAGGTGGG + Intronic
998465581 5:142341305-142341327 GAGAATTGCTTCAACTAGGGAGG + Intergenic
998538354 5:142955208-142955230 GAGGATTGCTTGAGTTCGAGAGG + Intronic
999089380 5:148922066-148922088 GAGAATTGCTTGAATTAGGGAGG - Intergenic
1000580238 5:163027247-163027269 GAGAATTGCTTGAATTCGAGAGG - Intergenic
1000907443 5:166979415-166979437 CAAAATTCCTTCACTTCGAGGGG - Intergenic
1001012750 5:168113228-168113250 GAGAATTGCTTGAGTCAGGGAGG + Intronic
1001013804 5:168122537-168122559 CAGATTTGCTCCATTTAGGGTGG - Intronic
1002118358 5:176983165-176983187 CAGTTTTGCTTCTGTTAGATAGG - Intronic
1002196944 5:177506418-177506440 CAGAATTGCTTGAGTCTGGGAGG - Intronic
1002545687 5:179943103-179943125 GAGAATTGCTTCAACCAGAGAGG + Intronic
1003609827 6:7601941-7601963 GAGAATTGCTTCAGCTTGGGAGG - Intronic
1004678899 6:17873033-17873055 CACAATTGCTTTAGTTCCAGAGG - Intronic
1005568670 6:27123382-27123404 CAGAATTGCTTGAATCAGGGAGG + Intergenic
1005811204 6:29517776-29517798 CAGAACTGCCTCAGGTGGAGAGG + Intergenic
1006844482 6:37052702-37052724 GAGAATTGCTTGAGTCAGGGAGG - Intergenic
1008263929 6:49400489-49400511 TAGAACTGCTGCAGCTAGAGGGG - Intergenic
1008977605 6:57446326-57446348 CAGAATAGCTTCAATAAGAAAGG + Intronic
1010426213 6:75731694-75731716 GAGAATTGCTTGAGTTTGGGAGG - Intergenic
1010717076 6:79242188-79242210 GAGAATTGCTTGAGCCAGAGAGG + Intergenic
1011924129 6:92620873-92620895 CACAATTGCATTAATTAGAGTGG - Intergenic
1011980003 6:93362758-93362780 CTTAATTGCTTAAGTTAAAGAGG - Intronic
1013531080 6:111019348-111019370 AAGAATTGCTTCAGCTTGGGAGG + Intronic
1013687656 6:112603443-112603465 CAGAATAGCTTGAGTAAGATTGG - Intergenic
1015098227 6:129442909-129442931 AACAATTGCTTCAGTTAAAATGG + Intronic
1019443136 7:1057415-1057437 CAGAAGTGCTGCAGGTACAGGGG - Intronic
1019821012 7:3242797-3242819 GAGAATTGCTTAAGTCAGGGAGG - Intergenic
1020988686 7:15168875-15168897 CAGAATTTCTCCAATGAGAGTGG - Intergenic
1021199557 7:17712761-17712783 CAGAATTTCTTCTGTTTCAGGGG - Intergenic
1022111293 7:27234003-27234025 GAGAATTGCTTCAATCAGGGAGG - Intergenic
1023772484 7:43570842-43570864 CAGAAATGCTTCAGTTTCAAAGG - Intergenic
1023939728 7:44761834-44761856 CACACATGCTTCAGGTAGAGTGG - Exonic
1026156647 7:67831902-67831924 GAGAATTGCTTGAACTAGAGAGG + Intergenic
1027472692 7:78592922-78592944 CAGAATTGCTTGAGCTCGGGAGG - Intronic
1028241701 7:88428984-88429006 CAAAATTGCTTCAGAGAAAGAGG + Intergenic
1028318025 7:89428172-89428194 CAGTTTTGCTGCAGATAGAGTGG - Intergenic
1028530608 7:91833905-91833927 CAGAATTGCTTCAGTGTGAGAGG - Intronic
1029136517 7:98376419-98376441 GAGAATTGCTTGAGCCAGAGAGG + Intronic
1031050849 7:116943916-116943938 CAGAATCCCTTCAGTCACAGTGG - Intergenic
1031184533 7:118459887-118459909 CAGAATTGTTTCACTTAGAAAGG - Intergenic
1032361511 7:131260133-131260155 CAGAATTGCTTGAGCTCGGGAGG - Intronic
1032992891 7:137413175-137413197 GAGAATTGCTTGAATTCGAGAGG + Intronic
1033443040 7:141397216-141397238 CAGAAATGGTACAGTGAGAGAGG + Intronic
1034610672 7:152365414-152365436 CAGAATTGCTCCAACTAGGGAGG + Intronic
1035015837 7:155765161-155765183 CAGAATTGCTTAAGTAAGATAGG - Intronic
1035173642 7:157034981-157035003 GAGAATTGCTTAAGTTCAAGAGG - Intergenic
1036088227 8:5636549-5636571 CAGAATTGCTTCAGCCTGAGGGG + Intergenic
1037402775 8:18509533-18509555 CAGAATTTCTTCAATCAGAGTGG - Intergenic
1037450266 8:19009799-19009821 GAGAATTGCTTGAGTCTGAGAGG + Intronic
1037662553 8:20940235-20940257 AAGAATTGCTTAAACTAGAGAGG + Intergenic
1038023453 8:23569172-23569194 AAGAATTGCTTGAGTTTGGGAGG + Intronic
1038784038 8:30594345-30594367 TAGAATTGCTTCAGCTGGGGAGG - Intronic
1039420664 8:37435600-37435622 CATAATATCATCAGTTAGAGGGG + Intergenic
1039614810 8:38946938-38946960 CAGAAATGCTTATGTTTGAGGGG + Intronic
1042428471 8:68676242-68676264 GAGAATTGCTTCAGCCAGGGAGG + Intronic
1043774896 8:84254322-84254344 CAGAATTGCTTCAGTTAGAGTGG - Intronic
1044498366 8:92919182-92919204 CAGAACTGCTTCAGCTATTGGGG + Intronic
1045068907 8:98479395-98479417 CAGAATTGCTTGAGTCCGGGAGG + Intronic
1047302190 8:123623013-123623035 CAGAATTATTTCAGTAAGACAGG - Intergenic
1050507110 9:6360054-6360076 GAGAATTGCTTCAATCCGAGAGG - Intergenic
1051508464 9:17850727-17850749 CAGAAGTCCTTCAATTAGTGGGG + Intergenic
1051559274 9:18422294-18422316 GAGAATTACTTCAGAAAGAGGGG - Intergenic
1052451099 9:28632231-28632253 CAGAATTGCATACGTTAAAGTGG + Intronic
1052749621 9:32476413-32476435 GAGAATCGCTTGAGTTTGAGAGG + Intronic
1055774901 9:79756674-79756696 AAGAAGTGATTCAGTTAGACAGG + Intergenic
1056321751 9:85441740-85441762 CAGAATTGTCTTAATTAGAGTGG - Intergenic
1059758937 9:117319947-117319969 CAGAATTGATTCACTGAAAGTGG + Intronic
1061424888 9:130492721-130492743 CAGAATTGCTCCAGTTAGAAAGG + Intronic
1062225535 9:135447491-135447513 CAGAATCGCTTCAGTCACAAGGG + Intergenic
1062642527 9:137527175-137527197 GAGAATTGCTTGAATCAGAGGGG + Intronic
1185700362 X:2226910-2226932 CAGAGTCGCTTTTGTTAGAGGGG + Intronic
1188813649 X:34684366-34684388 TAGAATAGCTTCAGTGGGAGTGG + Intergenic
1189761636 X:44327679-44327701 CAAAATTGCCTCAGGTATAGTGG + Intronic
1190032588 X:46988802-46988824 CAATATTGCTTCAGTTTCAGGGG - Intronic
1190767892 X:53490756-53490778 CAGAATTGCTTGAATTCGGGTGG - Intergenic
1190883877 X:54513313-54513335 CAGAATTGCTTGAATCAGGGAGG + Intergenic
1193590846 X:83386930-83386952 CTGAATTGTTTTATTTAGAGAGG + Intergenic
1194566705 X:95498046-95498068 GAGAATTGCTACAGATAAAGAGG + Intergenic
1197219272 X:123896154-123896176 CAGAATTGCTTGAGCCAGGGAGG - Intronic
1197494188 X:127156897-127156919 GAGAATTACTTCAGCCAGAGAGG + Intergenic
1198538031 X:137605750-137605772 CAGAATAGCTTCAGTAGGATTGG - Intergenic
1200737191 Y:6812689-6812711 CAGAATTGCTTTATTTGAAGGGG - Intergenic
1200777777 Y:7184926-7184948 GAGGATTGCTTCAGTCTGAGAGG + Intergenic
1201297938 Y:12480955-12480977 AAGAATTGCTTGAGCTCGAGAGG - Intergenic
1201682744 Y:16666918-16666940 GAGAATTGCTTGAGTTTGGGAGG - Intergenic