ID: 1043776886

View in Genome Browser
Species Human (GRCh38)
Location 8:84280581-84280603
Sequence ATGGTGATGTACTCTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043776886_1043776887 -10 Left 1043776886 8:84280581-84280603 CCACACACAGAGTACATCACCAT 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1043776887 8:84280594-84280616 ACATCACCATACCATAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043776886 Original CRISPR ATGGTGATGTACTCTGTGTG TGG (reversed) Intronic
900909293 1:5583474-5583496 ACGGTGCTGTTCTCTGTGAGCGG - Intergenic
904087261 1:27917648-27917670 ATTGGTATGTACTCTGTGTGTGG + Intergenic
904344549 1:29859436-29859458 AGGGAGATGCACCCTGTGTGGGG + Intergenic
907743984 1:57194176-57194198 ATGGTCAGTTACTCTGGGTGTGG - Intronic
907803679 1:57796916-57796938 ATTGTGATGTTCTCTGCCTGGGG + Intronic
908929654 1:69303538-69303560 TTCTTGCTGTACTCTGTGTGGGG + Intergenic
910676110 1:89818547-89818569 ATGGTGATTATCTCTGGGTGTGG - Intronic
913355478 1:117916672-117916694 ATGGTGATAGACTTTATGTGAGG + Intronic
917011999 1:170484930-170484952 ATGGTGTTGTGCTCTGTCGGGGG + Intergenic
917408750 1:174736573-174736595 CTGGTGGAGGACTCTGTGTGGGG + Intronic
917523927 1:175770543-175770565 ATGATCATGTGCTATGTGTGAGG + Intergenic
918313460 1:183303328-183303350 CTGGTGATCTGCTCTGTGTTAGG + Intronic
923202256 1:231724157-231724179 ATTGTCATATCCTCTGTGTGGGG + Intronic
1066138779 10:32481880-32481902 ATGGGGATTCTCTCTGTGTGAGG + Intronic
1067738627 10:48878551-48878573 ATGGAAATGTGCTCTGTGTCTGG - Intronic
1074707455 10:116147628-116147650 AGTTTGATGTGCTCTGTGTGAGG - Intronic
1074787390 10:116852929-116852951 ATGGTCCTGTAATCTGGGTGGGG - Intronic
1075184916 10:120247406-120247428 ATGATGATGGATTCTGTGGGAGG - Intergenic
1075649944 10:124120821-124120843 ATGGGTATGTAGTCTGTGTGGGG + Intergenic
1075746230 10:124729771-124729793 ATGCTGATAGACTCTGAGTGTGG - Intronic
1076337206 10:129715036-129715058 TTGGTAAATTACTCTGTGTGAGG - Intronic
1078177819 11:8983717-8983739 GGGGTGATGAACTCTGGGTGTGG + Intronic
1078748015 11:14133872-14133894 ATGGTGATGTCCTCTGCCTGGGG + Intronic
1079824687 11:25175754-25175776 ATGGTCATGAACTCTGTGCTAGG - Intergenic
1090547805 11:127784608-127784630 ATGGTGTTATCCTTTGTGTGGGG - Intergenic
1093114269 12:15190271-15190293 ATGTTAGTGTATTCTGTGTGTGG - Intronic
1094670750 12:32566483-32566505 CTGGTTATGTACTATGTGAGCGG - Intronic
1097598710 12:61666259-61666281 ATGGTGTTTTCCTCTTTGTGGGG - Intergenic
1099864837 12:88266845-88266867 ATGGTGTTGCCTTCTGTGTGTGG + Intergenic
1100286517 12:93172180-93172202 ATAGTGATATCCTCTGTATGGGG - Intergenic
1106075744 13:26459485-26459507 AGGGTGATATACCCTGTGTGGGG + Intergenic
1106888275 13:34214308-34214330 ATGGAAATTTACTCTGTGTCTGG - Intergenic
1107066821 13:36222582-36222604 ATGGTGTTAAACTCTCTGTGGGG + Intronic
1112224055 13:97519981-97520003 ATGTTGAAGTACTGTGTGTAGGG + Intergenic
1118581754 14:67307491-67307513 ATGATTATGTACTCTGTGCCAGG + Intronic
1123148999 14:106163552-106163574 ATGGTGGTTTACTCATTGTGCGG + Intergenic
1125612045 15:40978098-40978120 ATGTTGGTTTATTCTGTGTGAGG + Intergenic
1128896114 15:71375587-71375609 TTGATGATGTCCTCTGTGAGTGG + Intronic
1132394717 15:101464270-101464292 AAGGAGATGTCCACTGTGTGGGG + Intronic
1133581150 16:7145811-7145833 ATGGAGAAGTAGTGTGTGTGCGG - Intronic
1137748646 16:50842032-50842054 TTGGTGACGTACCCCGTGTGCGG - Intergenic
1138505278 16:57475385-57475407 ATGGTGGTGTGGTGTGTGTGGGG - Intronic
1138510582 16:57506456-57506478 CTGGTGCTGGACCCTGTGTGAGG + Intergenic
1142468472 17:148818-148840 ATGGGGAGAAACTCTGTGTGGGG - Intronic
1143047779 17:4096234-4096256 ATGATGATTTACTCTGTGTCAGG - Intronic
1144386390 17:14752372-14752394 ATGGTGATTTACTCTTTGTTAGG + Intergenic
1148822199 17:50366149-50366171 GGGGTGAGGTATTCTGTGTGGGG + Intergenic
1150612758 17:66747445-66747467 CGGGTGATGTCCTTTGTGTGTGG - Intronic
1156201814 18:34841823-34841845 ATCCTGATTAACTCTGTGTGGGG + Intronic
1156409856 18:36817298-36817320 ATGGTGTTGTCCTCTGTCAGAGG + Intronic
1159973268 18:74679043-74679065 ATGGGGAAATAATCTGTGTGGGG + Intronic
1160274197 18:77415517-77415539 TTGATGCTGTACTCTGTCTGCGG + Intergenic
1163004345 19:14388369-14388391 AGGGTGATGCACTTTGTGGGAGG - Intronic
1163063118 19:14774365-14774387 AGGGTGATGCACTTTGTGGGAGG + Intronic
925589071 2:5492438-5492460 ATGATGATTTACTTCGTGTGTGG + Intergenic
926333311 2:11843888-11843910 TTGGATATGTACTCTGTGTCAGG - Intergenic
927468197 2:23352316-23352338 CTGGTGAAGAACTCTCTGTGTGG - Intergenic
930987667 2:57609678-57609700 ATGGTGATGTCCTTTTGGTGTGG - Intergenic
935098502 2:99970058-99970080 ATGGTGATCTGCTCTGTGAGAGG + Intronic
937779691 2:125822848-125822870 ATGGTGGTGTACTAAGTGTTTGG + Intergenic
939965226 2:148604045-148604067 ATGGACATGTTCTCTGTGTGAGG - Intergenic
940135586 2:150432458-150432480 ATGGAGATCTGCTCTGTGGGTGG - Intergenic
941690506 2:168496538-168496560 ATAGAGCTGAACTCTGTGTGCGG - Intronic
941857753 2:170247911-170247933 ATGGTGAGGAGCACTGTGTGGGG + Intronic
944013276 2:195000552-195000574 TTGGTGTTGATCTCTGTGTGAGG - Intergenic
946398469 2:219455704-219455726 CTGGTGATGCCCTCTGTGGGTGG + Intronic
1168980517 20:1999594-1999616 GCAGTGATGTACTCTGTCTGGGG + Intergenic
1172323463 20:34016130-34016152 ATGCTGTGGTACTCGGTGTGTGG - Intronic
1174272306 20:49378521-49378543 TTGGTCATCTACTCTGCGTGAGG + Intronic
1175604822 20:60304183-60304205 ATTGTGATGGATTCAGTGTGAGG - Intergenic
1175614007 20:60377202-60377224 ATGGTGATGAATTGGGTGTGGGG + Intergenic
1177437131 21:21069876-21069898 AGGGTGATGAACTCTGTCTTGGG - Intronic
1177909811 21:27017252-27017274 ATAGTGATGTACTCTCTTTCGGG + Intergenic
1179107034 21:38410537-38410559 CTGTTAATGTACTCTGTATGTGG + Intronic
1179622910 21:42630612-42630634 TTGGTGATCTCCTCTGTTTGGGG + Intergenic
1184172696 22:42769143-42769165 ATGCTGCTCTCCTCTGTGTGAGG + Intergenic
1184742832 22:46439081-46439103 ACGTTGATGTCCTCCGTGTGTGG - Intronic
1185123129 22:48985684-48985706 TGTGTGATGTACTGTGTGTGCGG + Intergenic
951909887 3:27738670-27738692 ATAGTGATGTAGGCTGGGTGTGG - Intergenic
954083438 3:48225697-48225719 AAGGAGCTCTACTCTGTGTGTGG + Intergenic
954132919 3:48569341-48569363 AGGGTGGTGTACTCTCTGTGGGG - Intronic
957610743 3:82462120-82462142 ATGGTCATGAAGTCTTTGTGTGG + Intergenic
961471083 3:127113308-127113330 TTGCTGATGGGCTCTGTGTGTGG + Intergenic
963926714 3:150958694-150958716 AAGGAGAGGTACTCTATGTGAGG - Intronic
975828305 4:78342355-78342377 ATGGAGATGTCATATGTGTGGGG + Intronic
979251365 4:118569954-118569976 AGGGTGATGCACACTGGGTGAGG + Intergenic
982713008 4:158777510-158777532 ATGGTGGCCTACCCTGTGTGAGG + Intronic
991719069 5:69479126-69479148 ATGGTGATGTTCTGGGAGTGGGG - Intergenic
993431851 5:87841674-87841696 ATGGTGCTGTACTATCTGTTTGG + Intergenic
995165787 5:109040035-109040057 ATCCTGATGGACTCTGTATGTGG + Intronic
998302821 5:141041274-141041296 ATGGTGCTGAACTCTGGGCGTGG + Intergenic
1005923857 6:30423971-30423993 ATGGTGAAGCACTATGAGTGAGG - Intergenic
1010761481 6:79728223-79728245 CTGAAGATGTACTTTGTGTGAGG - Intergenic
1011098086 6:83688757-83688779 ATGGTGATGTTCACTTTGGGAGG - Intronic
1011453473 6:87521069-87521091 ATGGTTATGTACTATCTTTGGGG + Intronic
1023100414 7:36712250-36712272 ATCGTGAACCACTCTGTGTGTGG + Intronic
1023935865 7:44739310-44739332 CTGCTGCTGTACTCTGAGTGAGG + Intergenic
1024732385 7:52267194-52267216 ATGGTGATGTACTCTGGAGTAGG - Intergenic
1024771715 7:52731475-52731497 ATGGTGGGGGCCTCTGTGTGGGG - Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1037245674 8:16831840-16831862 ATGGTGCTGCAGCCTGTGTGTGG + Intergenic
1040362658 8:46682715-46682737 ATGATAATGTACTTGGTGTGTGG + Intergenic
1041993987 8:64030105-64030127 CTGATGATGCCCTCTGTGTGGGG - Intergenic
1043776886 8:84280581-84280603 ATGGTGATGTACTCTGTGTGTGG - Intronic
1048576595 8:135695227-135695249 ATTGTTATATACTCTGTGTATGG - Intergenic
1050975336 9:11929593-11929615 AATGTGATGTTCTTTGTGTGTGG + Intergenic
1051486724 9:17616472-17616494 AAGGTGGTGTACTTTTTGTGGGG + Intronic
1059015789 9:110514219-110514241 ATGGTGATGTAGGCTGGGTGTGG + Intronic
1189038127 X:37513665-37513687 AAGGTGATCAACTCTGTTTGAGG - Intronic
1190386362 X:49885486-49885508 ATGGTTCTGAACTCTGTGGGTGG - Intergenic
1193766064 X:85529968-85529990 CTGTTGGAGTACTCTGTGTGAGG - Intergenic
1193831507 X:86294665-86294687 CTGTTGGAGTACTCTGTGTGAGG + Intronic
1196192995 X:112813635-112813657 ATGGTGATTTTTTGTGTGTGTGG - Intronic
1197493714 X:127152392-127152414 GTGGTGATGTAGTTTGTGTGTGG + Intergenic
1197803705 X:130378830-130378852 ATGGAGTTGTACTCTGTGAGAGG + Intergenic
1201738795 Y:17301502-17301524 ATGATGAGGCACACTGTGTGAGG + Intergenic